WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128959 Gene Name  Cjp-unc-34
Sequence Name  ? CJA09755 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: VASP tetramerisation domain superfamily; WH1 domain; PH-like domain superfamily; VASP tetramerisation; VASP tetramerisation domain; and WH1/EVH1 domain. Is an ortholog of C. elegans unc-34. In C. elegans, unc-34 is involved in axon development; gonad morphogenesis; and positive regulation of locomotion. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09755.1 CJA09755.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09755 CJA09755   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22729, ATATCATAAAGCCACACCAAAGTTTCATCAGTGGCGAGACGAGAGGCGACGAGTTTATGG, WBGene00178301   Expr1091560 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-unc-34, AAAAAGTGGTCCGTTTCGGATGCGTCGAAGCCAACTGATAGTCCGAAATCGCATCGGAAG, WBGene00128959   Expr1090730 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term