WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060577 Gene Name  CRE03747
Sequence Name  ? CRE03747 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: FAD dependent oxidoreductase; Glycine cleavage T-protein/YgfZ, C-terminal; FAD/NAD(P)-binding domain superfamily; FAD dependent oxidoreductase, central domain; Aminomethyltransferase folate-binding domain; Glycine cleavage T-protein C-terminal barrel domain; Glycine cleavage T-protein, C-terminal barrel domain; GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1; FAD dependent oxidoreductase central domain; and Aminomethyltransferase, folate-binding domain. Is an ortholog of C. elegans Y37E3.17. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE03747.1 CRE03747.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE03747 CRE03747   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE03747, TCACGTTTGACACCGAAGAGGGAATCGTTTTGGACGATAAATATGTTCCAAGTGGAAATG, WBGene00060577   Expr1098508 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term