WormMine: Gene WBGene00064873

• WormBase Gene ID: WBGene00064873
• Gene Name: Cre-dac-1
• Sequence Name: CRE25707
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ski-like, DNA-binding domain superfamily; Putative DNA-binding domain superfamily; SKI/SNO/DAC family; and SKI/SNO/DAC domain. Is an ortholog of C. elegans dac-1. In C. elegans, dac-1 is involved in thermotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25707.1	CRE25707.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25707	CRE25707		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095814
• Remark: Cre-dac-1, TCGAGAAACGTTACAAGTATGTGAATCGTCAATTGCTATTGGTGAATGCAGAACTACGGA, WBGene00064873
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term