WormMine: Gene WBGene00064787

• WormBase Gene ID: WBGene00064787
• Gene Name: CRE11256
• Sequence Name: CRE11256
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Short-chain dehydrogenase/reductase SDR; short chain dehydrogenase; and NAD(P)-binding domain superfamily. Is an ortholog of C. elegans C55A6.7. In C. elegans, C55A6.7 is involved in defense response to Gram-negative bacterium and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11256.1	CRE11256.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11256	CRE11256		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101547
• Remark: CRE11256, GATGCTCCTCACTCAATCGCTGGTCCCCCTGATCGTAAAATCCGCGAGCCAAGTTAGTAC, WBGene00064787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term