WormMine: Gene WBGene00064604

• WormBase Gene ID: WBGene00064604
• Gene Name: Cre-fln-1
• Sequence Name: CRE31442
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Calponin homology (CH) domain; Calponin homology domain; Immunoglobulin E-set; Filamin/ABP280 repeat-like; Filamin/ABP280 repeat; CH domain superfamily; and Immunoglobulin-like fold. Is an ortholog of C. elegans fln-1. In C. elegans, fln-1 is involved in several processes, including axon development; semaphorin-plexin signaling pathway; and uterus morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31442.1	CRE31442.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31442	CRE31442		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117736
• Remark: CRE31442, GAAGCCGTTCCAGGATTGAAGCCGAGTGCAACGCGAGTAACAGGAATCGATGAGAACAAG, WBGene00064604
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term