WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025529 Gene Name  Cbr-osta-2
Sequence Name  ? CBG02483 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Organic solute transporter Ostalpha and Organic solute transporter subunit alpha/Transmembrane protein 184. Is an ortholog of C. elegans osta-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02483b.1 CBG02483b.1   [unknown]
Transcript:CBG02483a.2 CBG02483a.2   [unknown]
Transcript:CBG02483a.1 CBG02483a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02483a CBG02483a   [unknown]
CDS:CBG02483b CBG02483b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02483, CAAAGTTTTGGACTTTATAACTCTTCCATCTCTTTTGGCTGGAATCTACGGTACACATAT, WBGene00025529   Expr1067239 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term