WormMine: Gene WBGene00025799

• WormBase Gene ID: WBGene00025799
• Gene Name: Cbr-flp-16
• Sequence Name: CBG02820
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans flp-16. In C. elegans, flp-16 is involved in cellular response to carbon dioxide; negative regulation of nematode pharyngeal pumping; and negative regulation of striated muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02820b.1	CBG02820b.1		[unknown]
Transcript:CBG02820a.1	CBG02820a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02820b	CBG02820b		[unknown]
CDS:CBG02820a	CBG02820a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058063
• Remark: Cbr-flp-16, AAAAAGAGCACAGACGTTCGTGAGATTTGGAAAGCGAGGACAGACTTTTGTACGATTCGG, WBGene00025799
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term