WormMine: Gene WBGene00063504

• WormBase Gene ID: WBGene00063504
• Gene Name: CRE02982
• Sequence Name: CRE02982
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Putative zinc-RING and/or ribbon and Protein kinase C-like, phorbol ester/diacylglycerol-binding domain. Is an ortholog of C. elegans F20H11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02982.1	CRE02982.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02982	CRE02982		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110052
• Remark: CRE02982, AACGACGTCGAAAACGAAGTGAACTGCCGAAGACGTTGAGCAGTAGTGATGAGAAGGAGA, WBGene00063504
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term