WormMine: Gene WBGene00068240

• WormBase Gene ID: WBGene00068240
• Gene Name: CRE02528
• Sequence Name: CRE02528
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srbc and 7TM GPCR, serpentine receptor class bc (Srbc). Is an ortholog of C. elegans C30G7.5; F41H8.1; and K09C6.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02528.1	CRE02528.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02528	CRE02528		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096413
• Remark: CRE02528, ATTTCAACCTCGTCTTCTATTTTTCTGCTAGTGATTTTCTAGCGGCAGTATTCGAAATAC, WBGene00068240
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term