WormMine: Gene WBGene00029205

• WormBase Gene ID: WBGene00029205
• Gene Name: Cbr-ubxn-3
• Sequence Name: CBG07030
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: UBX domain; UAS; Ubiquitin-like domain superfamily; UBA-like domain; UBA-like superfamily; and Thioredoxin-like superfamily. Is an ortholog of C. elegans ubxn-3. In C. elegans, ubxn-3 is involved in several processes, including developmental process involved in reproduction; positive regulation of mitotic cell cycle, embryonic; and regulation of protein localization to chromatin.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07030.1	CBG07030.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07030	CBG07030		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054030
• Remark: Cbr-ubxn-3, AAAAGGAGATCACTCGTCACTTTGATCTTTCGACAAACTTCACCGACTCAAAATGGCCAG, WBGene00029205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term