WormMine: Gene WBGene00033672

• WormBase Gene ID: WBGene00033672
• Gene Name: Cbr-unc-87
• Sequence Name: CBG12778
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Calponin repeat and Calponin family repeat. Is an ortholog of C. elegans unc-87. In C. elegans, unc-87 is involved in actin cytoskeleton organization and negative regulation of muscle filament sliding.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12778a.1	CBG12778a.1		[unknown]
Transcript:CBG12778b.1	CBG12778b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12778a	CBG12778a		[unknown]
CDS:CBG12778b	CBG12778b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055906
• Remark: Cbr-unc-87, GAAGGTTTCGGAGACCATCATTCCAAGTCAAGCTGGATGGAATAAGGGAGACTCTCAGAA, WBGene00033672
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term