WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00069720 Gene Name  Cre-hrpu-1
Sequence Name  ? CRE17539 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: SPRY domain; P-loop containing nucleoside triphosphate hydrolase; Concanavalin A-like lectin/glucanase domain superfamily; AAA domain; and SAP domain. Is an ortholog of C. elegans hrpu-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE17539.1 CRE17539.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE17539 CRE17539   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE22745, CGAGATCGCCGCTGGAATCAAGCCAAAGAAGAAGGATAAGAAGCCGTTGGTGCAGATTCC, WBGene00075812   Expr1097012 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE17539, CTTTGTGCCAGATGAGGATACGCATCAGAAGAGACTGATCAAGCAGGAACATGAGGAGAA, WBGene00069720   Expr1094872 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term