WormMine: Gene WBGene00182368

• WormBase Gene ID: WBGene00182368
• Gene Name: Cjp-damt-1.2
• Sequence Name: CJA26796
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: MT-A70-like; S-adenosyl-L-methionine-dependent methyltransferase; and MT-A70. Is an ortholog of C. elegans damt-1. In C. elegans, damt-1 is involved in epigenetic regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA26796b.1	CJA26796b.1		[unknown]
Transcript:CJA26796a.1	CJA26796a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA26796b	CJA26796b		[unknown]
CDS:CJA26796a	CJA26796a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088559
• Remark: CJA26796, GACTTGATCGTCGCCGATCCGCCATGGATGAGCAAGTCGGTGAAGAGGAAGAAAACGTAA, WBGene00182368
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term