WormMine: Gene WBGene00028961

• WormBase Gene ID: WBGene00028961
• Gene Name: Cbr-somi-1
• Sequence Name: CBG06725
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: C2H2-type zinc-finger domain. Is an ortholog of C. elegans somi-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06725a.1	CBG06725a.1		[unknown]
Transcript:CBG06725d.1	CBG06725d.1		[unknown]
Transcript:CBG06725c.1	CBG06725c.1		[unknown]
Transcript:CBG06725b.1	CBG06725b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06725c	CBG06725c		[unknown]
CDS:CBG06725b	CBG06725b		[unknown]
CDS:CBG06725a	CBG06725a		[unknown]
CDS:CBG06725d	CBG06725d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058252
• Remark: Cbr-somi-1, GGAGATCGGTTACAAGAGAGACTAGCAGCGCACAAGGCAAACTCATCCAGAGGGCGGAAG, WBGene00028961
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term