WormMine: Gene WBGene00131058

• WormBase Gene ID: WBGene00131058
• Gene Name: CJA11854
• Sequence Name: CJA11854
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Tc1-like transposase, DDE domain and DDE superfamily endonuclease. Is an ortholog of C. elegans Y54G2A.42.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11854c.1	CJA11854c.1		[unknown]
Transcript:CJA11854b.1	CJA11854b.1		[unknown]
Transcript:CJA11854a.1	CJA11854a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11854c	CJA11854c		[unknown]
CDS:CJA11854a	CJA11854a		[unknown]
CDS:CJA11854b	CJA11854b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073995
• Remark: CJA11854, AACTTCTCGAAATCGGTCATACGAAGGACAGCATCTTACAAGGGAAGTGTTTAGGGTCAC, WBGene00131058
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term