WormMine: Gene WBGene00130185

• WormBase Gene ID: WBGene00130185
• Gene Name: Cjp-efsc-1
• Sequence Name: CJA10981
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ribosome biogenesis protein BMS1/TSR1, C-terminal; 40S ribosome biogenesis protein Tsr1 and BMS1 C-terminal; and Translation protein, beta-barrel domain superfamily. Is an ortholog of C. elegans efsc-1. In C. elegans, efsc-1 is involved in selenocysteine incorporation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10981.1	CJA10981.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10981	CJA10981		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075522
• Remark: Cjp-selb-1, TCTTATCATCACGTCTTCCGGAAAGTGCGGAAAAATAGAAGGAGCATTTGGGAAATCTGG, WBGene00130185
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term