WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133508 Gene Name  Cjp-xol-1
Sequence Name  ? CJA14304 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal protein S5 domain 2-type fold; Switch protein XOL-1, N-terminal; GHMP kinase, C-terminal domain superfamily; Switch protein XOL-1, GHMP-like; and Ribosomal protein S5 domain 2-type fold, subgroup. Is an ortholog of C. elegans xol-1. In C. elegans, xol-1 is involved in dosage compensation by hypoactivation of X chromosome; intergenic mRNA trans splicing; and male sex determination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA14304.1 CJA14304.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA14304 CJA14304   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-xol-1, AGGTTCTCGAGGGGTACGAAGTTCAGCAAGGAGGAGTTTTTGTAGTTCTCAAAAAGGGAG, WBGene00133508   Expr1086463 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA27076, GAGGAAGAGGACGAGGATGTTGGTGAATCTGATTCCGAGATGAATGCAGATGAAACTTTT, WBGene00182648   Expr1082902 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term