WormMine: Gene WBGene00131246

• WormBase Gene ID: WBGene00131246
• Gene Name: CJA12042
• Sequence Name: CJA12042
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Mitochondrial substrate/solute carrier; Mitochondrial carrier protein; and Mitochondrial carrier domain superfamily.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12042b.1	CJA12042b.1		[unknown]
Transcript:CJA12042a.1	CJA12042a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12042b	CJA12042b		[unknown]
CDS:CJA12042a	CJA12042a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083213
• Remark: CJA12042, GCTCCTCGACCACAATCTCATCAACAACGTCACCAAGCAGGCGGAGCAGATTTGTGCGGA, WBGene00131246
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term