WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135578 Gene Name  Cjp-paa-1
Sequence Name  ? CJA16374 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold; HEAT repeat; HEAT repeats; Armadillo-like helical; SWIB/MDM2 domain superfamily; SWIB domain; and SWIB/MDM2 domain. Is an ortholog of C. elegans paa-1. In C. elegans, paa-1 is involved in embryo development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16374b.1 CJA16374b.1   [unknown]
Transcript:CJA16374a.1 CJA16374a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16374a CJA16374a   [unknown]
CDS:CJA16374b CJA16374b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-paa-1, AAGCTTCAGAAGGACACCAACTACTTGCAGAGAATGACGTGCCTATTTTGTTTGAACACT, WBGene00135578   Expr1085889 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA08332, ATAGGACAAAGTGACATGACACCGGAGCTCAGAGAGGAGAGTGAGAGAGAAATGGAGAAG, WBGene00127537   Expr1075825 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term