WormMine: Gene WBGene00135425

• WormBase Gene ID: WBGene00135425
• Gene Name: Cjp-frm-3
• Sequence Name: CJA16221
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: FERM, N-terminal; FERM central domain; FERM N-terminal domain; Band 4.1 domain; FERM superfamily, second domain; FERM adjacent (FA); Ubiquitin-like domain superfamily; FERM C-terminal PH-like domain; PH-like domain superfamily; FERM, C-terminal PH-like domain; and FERM/acyl-CoA-binding protein superfamily. Is an ortholog of C. elegans frm-3. In C. elegans, frm-3 is involved in gamma-aminobutyric acid receptor clustering.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16221.1	CJA16221.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16221	CJA16221		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088260
• Remark: Cjp-frm-3, AATGTGTATCCGAATCCAGAAGTCTTCATGAAGATATGGACCGCCTTGATAAAACCACTC, WBGene00135425
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term