WormMine: Gene WBGene00134247

• WormBase Gene ID: WBGene00134247
• Gene Name: Cjp-clec-63
• Sequence Name: CJA15043
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; von Willebrand factor A-like domain superfamily; von Willebrand factor type A domain; von Willebrand factor, type A; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans clec-63.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15043.1	CJA15043.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15043	CJA15043		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088758
• Remark: Cjp-clec-63, AGCTCCAGTTTGTCGGTTGGATGGCAAAATATCAACGCATACAGCGTCGCCGAATATTAC, WBGene00134247
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term