WormMine: Gene WBGene00134167

• WormBase Gene ID: WBGene00134167
• Gene Name: CJA14963
• Sequence Name: CJA14963
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: FERM superfamily, second domain; FERM central domain; and FERM/acyl-CoA-binding protein superfamily. Is an ortholog of C. elegans frm-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14963b.1	CJA14963b.1		[unknown]
Transcript:CJA14963a.1	CJA14963a.1		[unknown]
Transcript:CJA14963c.1	CJA14963c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14963b	CJA14963b		[unknown]
CDS:CJA14963a	CJA14963a		[unknown]
CDS:CJA14963c	CJA14963c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089603
• Remark: CJA14963, CAAGTCAATGACGAGTACGAAAAGTTTATCGTTGGCGCGCGATTGGTGCCCACGGAACAC, WBGene00134167
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term