WormMine: Gene WBGene00133841

• WormBase Gene ID: WBGene00133841
• Gene Name: Cjp-toca-2
• Sequence Name: CJA14637
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Fes/CIP4, and EFC/F-BAR homology domain; AH/BAR domain superfamily; SH3-like domain superfamily; SH3 domain; and FCH domain. Is an ortholog of C. elegans toca-2. In C. elegans, toca-2 is involved in several processes, including negative regulation of protein localization to adherens junction; positive regulation of egg-laying behavior; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14637a.1	CJA14637a.1		[unknown]
Transcript:CJA14637b.1	CJA14637b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14637a	CJA14637a		[unknown]
CDS:CJA14637b	CJA14637b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090533
• Remark: Cjp-toca-2, AAAAAGAACCAAGAAATTGGCTTCGTGCCCACCTCGTACCTTCAATTCACAGCCATTCCC, WBGene00133841
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term