WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00179616 Gene Name  CJA24044
Sequence Name  ? CJA24044 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: IQ calmodulin-binding motif; IQ motif, EF-hand binding site; and Mitochondrial carrier domain superfamily. Is an ortholog of C. elegans F25B4.7. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA24044.1 CJA24044.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA24044 CJA24044   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA12419, TGTCAGGAGACGGCTTATGATGGGCGCCGGAAACAAGGTTATTCCATTTCACAATACAAT, WBGene00131623   Expr1085988 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24044, GCCATTGCTGGAAGAACTGTAGCCGCAACCACATCGTCGATCGAGGCAAAACTGAGAAAG, WBGene00179616   Expr1090666 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term