WormMine: Gene WBGene00181621

• WormBase Gene ID: WBGene00181621
• Gene Name: Cjp-pdpr-1
• Sequence Name: CJA26049
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: FAD dependent oxidoreductase; FAD/NAD(P)-binding domain superfamily; FAD dependent oxidoreductase, central domain; Aminomethyltransferase folate-binding domain; GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1; FAD dependent oxidoreductase central domain; and Aminomethyltransferase, folate-binding domain. Is an ortholog of C. elegans pdpr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA26049a.1	CJA26049a.1		[unknown]
Transcript:CJA26049b.1	CJA26049b.1		[unknown]
Transcript:CJA26049c.1	CJA26049c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA26049a	CJA26049a		[unknown]
CDS:CJA26049b	CJA26049b		[unknown]
CDS:CJA26049c	CJA26049c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074257
• Remark: CJA26049, CAGCGAGTACGAGGCGTGTCGAGAAAGAGTAGGATTGATGGATATGAGCAGTTTCAGCAA, WBGene00181621
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term