WormMine: Gene WBGene00036697

• WormBase Gene ID: WBGene00036697
• Gene Name: Cbr-dim-1
• Sequence Name: CBG16888
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Immunoglobulin subtype; Basigin-like; Immunoglobulin I-set; Immunoglobulin subtype 2; Immunoglobulin I-set domain; Immunoglobulin-like fold; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans dim-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16888a.1	CBG16888a.1		[unknown]
Transcript:CBG16888b.1	CBG16888b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16888b	CBG16888b		[unknown]
CDS:CBG16888a	CBG16888a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

2 Expression Patterns

• Primary Identifier: Expr1061760
• Remark: Cbr-dim-1, GCTTCGACATTGGATACTCAGCAAGAATGAACCCACAAGTCACCTGGATCTCACCAAAGT, WBGene00036697
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1064645
• Remark: CBG27845, CGAAGGAGAATCTGAAGATACAAAACGCCCCAGGATCAGTAAAGAACCCTTGCTGCCACG, WBGene00089259
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term