WormMine: Gene WBGene00035069

• WormBase Gene ID: WBGene00035069
• Gene Name: Cbr-mtm-5
• Sequence Name: CBG14641
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DENN domain, C-terminal lobe; Myotubularin-like phosphatase domain; Myotubularin family; GRAM domain; uDENN domain; Pleckstrin homology domain; PH domain; Protein-tyrosine phosphatase-like; cDENN domain; dDENN domain; PH-like domain superfamily; SBF1/SBF2 domain; Myotubularin protein; and DENN (AEX-3) domain. Is an ortholog of C. elegans mtm-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14641.1	CBG14641.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14641	CBG14641		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068896
• Remark: Cbr-mtm-5, GTATCATCTAACAATCTCCCACCACTTTGTAGCGGATATTTGTCGAAACGAGGTGCCAAA, WBGene00035069
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term