WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00182890 Gene Name  CJA27318
Sequence Name  ? CJA27318 Organism  Caenorhabditis japonica
Biotype  SO:0001217 Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA27318a.1 CJA27318a.1   [unknown]
Transcript:CJA27318b.1 CJA27318b.1   [unknown]
Transcript:CJA27318c.1 CJA27318c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA27318b CJA27318b   [unknown]
CDS:CJA27318a CJA27318a   [unknown]
CDS:CJA27318c CJA27318c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28811, AATTGGTGACGGAAAGGCTAGAAAACACTCAACACGTCACTGCCTTCTTGAACTATTCGA, WBGene00184385   Expr1084669 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term