WormMine: Gene WBGene00212593

• WormBase Gene ID: WBGene00212593
• Gene Name: CJA36746
• Sequence Name: CJA36746
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Acyl transferase/acyl hydrolase/lysophospholipase. Is an ortholog of C. elegans ipla-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA36746c.1	CJA36746c.1		[unknown]
Transcript:CJA36746b.1	CJA36746b.1		[unknown]
Transcript:CJA36746a.1	CJA36746a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA36746b	CJA36746b		[unknown]
CDS:CJA36746c	CJA36746c		[unknown]
CDS:CJA36746a	CJA36746a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091602
• Remark: CJA17097, AAACGTCGCTGGAACCCGCCATCCTTCTCATGCTCAGAAGACGGTCAGGACCATCTAAAA, WBGene00136301
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term