WormMine: Gene WBGene00213111

• WormBase Gene ID: WBGene00213111
• Gene Name: Cjp-dnj-1.3
• Sequence Name: CJA37264
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function (DUF1977) and Domain of unknown function DUF1977, DnaJ-like. Is an ortholog of C. elegans dnj-1. In C. elegans, dnj-1 is involved in protein-containing complex assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA37264.1	CJA37264.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA37264	CJA37264		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078159
• Remark: Cjp-dnj-1, TGAGGCCCGACTTTGAAACGAGCTATCGAGGAAGAATACGACAAGTTGAACAACAAGTCG, WBGene00129282
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term