WormMine: Gene WBGene00212533

• WormBase Gene ID: WBGene00212533
• Gene Name: CJA36686
• Sequence Name: CJA36686
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: NagB/RpiA transferase-like. Is an ortholog of C. elegans eif-2Bdelta. In C. elegans, eif-2Bdelta is involved in several processes, including determination of adult lifespan; lipid storage; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA36686.1	CJA36686.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA36686	CJA36686		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077158
• Remark: CJA08699, GAATTCTCGAGGCAGAGGGATTCGACACGTGAAGAGCTTCACTGATAGAGGATATAAAGT, WBGene00127903
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term