WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00218518 Gene Name  CJA42670
Sequence Name  ? CJA42670 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Transactive response DNA-binding protein N-terminal domain and TAR DNA-binding protein 43, N-terminal. Is an ortholog of C. elegans C27H5.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA42670.1 CJA42670.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA42670 CJA42670   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28323, GAACAACTCGGCCACCTTCAATCGATTGTGGAGGCAGCGACTCGCGAAGCAGCTGAAAAT, WBGene00183897   Expr1074510 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA09036, TGGTCAGTGAGGCGTTGAAACGATTGGAGGAGTCCAGAAGTACGGTAAGCAAATCTTTTA, WBGene00128240   Expr1078440 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term