WormMine: Gene WBGene00031355

• WormBase Gene ID: WBGene00031355
• Gene Name: CBG09839
• Sequence Name: CBG09839
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Transmembrane protein family 132, middle domain; Transmembrane protein 132; and Transmembrane protein family 132. Is an ortholog of C. elegans Y71H2AM.10. In C. elegans, Y71H2AM.10 is involved in dopaminergic neuron differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09839.1	CBG09839.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09839	CBG09839		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060295
• Remark: CBG09839, AGAGCTGCCAGACAGTTTGCATGTGTGAATCGATTCCAAAATGGACATGTATGTATTTTG, WBGene00031355
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term