WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030109 Gene Name  Cbr-nape-2
Sequence Name  ? CBG08290 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ribonuclease Z/Hydroxyacylglutathione hydrolase-like; Metallo-beta-lactamase; and Beta-lactamase superfamily domain. Is an ortholog of C. elegans nape-2. In C. elegans, nape-2 is involved in N-acylethanolamine metabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08290.1 CBG08290.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08290 CBG08290   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-nape-2, CGAAGATCTCAAGGACACAAATTTTGTGACAATTGAAATGGGCCGCATTTGGGAGGCTCC, WBGene00030109   Expr1066833 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term