WormMine: Gene WBGene00023818

• WormBase Gene ID: WBGene00023818
• Gene Name: CBG00429
• Sequence Name: CBG00429
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily; Fructosamine/Ketosamine-3-kinase; and Fructosamine kinase. Is an ortholog of C. elegans Y116A8C.25.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00429c.1	CBG00429c.1		[unknown]
Transcript:CBG00429d.1	CBG00429d.1		[unknown]
Transcript:CBG00429a.1	CBG00429a.1		[unknown]
Transcript:CBG00429b.1	CBG00429b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00429d	CBG00429d		[unknown]
CDS:CBG00429c	CBG00429c		[unknown]
CDS:CBG00429b	CBG00429b		[unknown]
CDS:CBG00429a	CBG00429a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068212
• Remark: CBG00429, TGTTTTTGATCCATCCTCCAGTTATTCGGATCCTGAGTTTGAATTTGGAATTATGCAAAT, WBGene00023818
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term