WormMine: Gene WBGene00035297

• WormBase Gene ID: WBGene00035297
• Gene Name: CBG14923
• Sequence Name: CBG14923
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Small-subunit processome, Utp12; Periodic tryptophan protein 2; Dip2/Utp12 Family; WD40-repeat-containing domain superfamily; WD40/YVTN repeat-like-containing domain superfamily; WD domain, G-beta repeat; and WD40 repeat. Is an ortholog of C. elegans F55F8.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14923.1	CBG14923.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14923	CBG14923		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055703
• Remark: CBG14923, CTCTTTCAACATTGTATGCGGAACGTCTTCTGAAGTGGATGGTCGAAGGTAATGTAATGT, WBGene00035297
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term