WormMine: Gene WBGene00038946

• WormBase Gene ID: WBGene00038946
• Gene Name: Cbr-eipr-1
• Sequence Name: CBG19781
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD domain, G-beta repeat; WD40 repeat; WD40-repeat-containing domain superfamily; and EARP and GARP complex-interacting protein 1. Is an ortholog of C. elegans eipr-1. In C. elegans, eipr-1 is involved in positive regulation of dense core granule transport; positive regulation of egg-laying behavior; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19781.1	CBG19781.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19781	CBG19781		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069142
• Remark: CBG19781, GCTCAGATGCATCCGTTGTTCTTTCGTGTGCTCAAAGTGTCAGTAGTGAGCAATTGAAAG, WBGene00038946
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term