WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00182843 Gene Name  CJA27271
Sequence Name  ? CJA27271 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class v (Srv) and Serpentine type 7TM GPCR chemoreceptor Srv. Is an ortholog of C. elegans srv-14. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA27271.1 CJA27271.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA27271 CJA27271   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA27271, TGCAAGCATTAATCCCTATCTACTCTGGATATTCTCTGATTCGCTTCGAAAACATGCATT, WBGene00182843   Expr1085038 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA05648, GCAATTGCAATTCAATTCCTTCCTGGAATGTTTATGGGCTCTCTGACGTTTTTCAATACA, WBGene00124852   Expr1079858 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term