WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025522 Gene Name  CBG02475
Sequence Name  ? CBG02475 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Vacuolar protein sorting-associated protein 13, second N-terminal domain; Vacuolar protein sorting-associated protein 13; SHR-binding domain of vacuolar-sorting associated protein 13; Ricin B-like lectins; Vacuolar sorting-associated protein 13, N-terminal; Vacuolar protein sorting-associated protein 13, SHR-binding domain; Vacuolar-sorting-associated 13 protein C-terminal; Vacuolar protein sorting-associated protein 13, C-terminal; N-terminal region of Chorein or VPS13; and Vacuolar protein sorting-associated protein 13-like, N-terminal domain. Is an ortholog of C. elegans C25H3.11. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02475b.1 CBG02475b.1   [unknown]
Transcript:CBG02475a.1 CBG02475a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02475b CBG02475b   [unknown]
CDS:CBG02475a CBG02475a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02475, AATCTAGCTCATGCTCAGATGGAGTTACTCCGCATTAATGGATACTCGTCTAGAGAACAA, WBGene00025522   Expr1063577 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG02477, ATCCCGACGACTTCTGGAGCAAATAGTCTGAAGCCGGAAATGACCATAAAGATGACTTAT, WBGene00025524   Expr1063531 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term