WormMine: AnatomyTerm WBbt:0004506

• Definition: Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad
• Name: posterior distal tip cell
• Primary Identifier: WBbt:0004506
• Synonym: gon herm dtc P

1 Children

Definition	Name	Synonym	Primary Identifier
nucleus of pedigree Z4.pp	Z4.pp nucleus		WBbt:0002042

0 Expression Clusters

233 Expression Patterns

• Primary Identifier: Expr4881
• Remark: Picture: Fig. 2A, B.
• Pattern: The Venus expression began during the early L2 stage when DTCs start to migrate and was maintained specifically in DTCs until the adult stage.

• Primary Identifier: Expr4882
• Remark: Picture: Fig. 2C.
• Pattern: Although the signal was very faint, expression of the full-length mig-24::venus translational fusion construct in hermaphrodites, which fully rescues the mig-24 phenotype, was detected only in DTC nuclei. Expression of mig-24::venus was observed in males, where the signal was detected specifically in MLCs from L2 through L4 stages. Thus, MIG-24 is expressed specifically in gonadal leader cells both in hermaphrodites and males.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr4872
• Remark: Picture: Figure 2. Similar DTC expression of GFP was observed in two other independently derived 6-kb pat-2 promoter fusion lines as well as with shorter promoter fusions of 3, 2, and <0.5 kb of pat-2 upstream sequence. To verify that this pattern is an accurate representation of PAT-2 expression, a translational fusion line with GFP inserted near the end of the cytoplasmic tail was examined. The PAT-2::GFP expression pattern was the same as the transcriptional fusions, including the up-regulation of expression in the DTC during L3.
• Pattern: In each line, the pat-2p::GFP nematodes had high levels of GFP expression in body-wall muscle cells and vulval tissue. No GFP was detected in the DTCs migrating on the ventral ECM during L2. GFP was visible in DTCs during L3, when the DTC migrates from the ventral to dorsal surface, and was maintained in the DTC throughout adulthood.

• Primary Identifier: Expr4842
• Pattern: A-class motor neuron: enriched in embryo (2.9); not expressed in larva. Neuronal expression include: Weak in head and tail neurons, ventral cord. Also expressed in other cells: Pharynx, sheath cells, distal tip cell. Pan-neuronal: enriched in embryo (1.9); expressed in larva.

• Primary Identifier: Expr4843
• Pattern: A-class motor neuron: expressed in larva; enriched in embryo (2.0). Neuronal expression include: Bright in head neurons, few tail neurons. weak in all ventral cord motor neurons. Touch neurons, PDE. Also expressed in other cells: Intestine, head muscle, pharyngeal muscle, hypodermis, distal tip cell. Pan-neuronal: expressed in larva; enriched in embryo(3.0).

• Primary Identifier: Expr4837
• Remark: Picture: Figure 5.
• Pattern: Fluorescence started to be visible in two cells of young embryos at around the 64 AB cell stage. Towards the end of gastrulation expression was visible in about 40 cells throughout the embryo including neuronal precursors, ventral hypodermal cells, and pharyngeal precursor cells. At the 1 to 2 fold stages fluorescence was observed in IL1 neurons (the identity was determined post-embryonically), the nine buccal epidermal cells, and additional cells in the head, most likely arcade cells. Transient expression was also observed in embryonic motoneurons (no longer visible in 3 fold stage embryos) and in a few apoptotic cells in the head. Based on their position they could be the sister cells of some of the IL1 neurons, which are known to undergo programmed cell death at this developmental stage. At the 3 fold stage expression was restricted to the buccal epidermal cells, most of the arcade cells (3 anterior and the DL and DR posterior arcade cells), and the six IL1 neurons. The two lateral IL1 neurons expressed the marker only weakly also in the L1 larval stage (but not later during development), whereas the dorsal and ventral IL1 neurons expressed GFP strongly throughout all larval stages and in the adults. Starting from the L1 larval stage expression could also be observed in the posterior cells of the gut. Starting from the L2 stage, when gonad development and migration begins, fluorescence became also visible in the distal tip cells of the gonad.

• Primary Identifier: Expr4826
• Remark: Picture: fig. S3 A.
• Pattern: A transgene containing the sel-10 promoter driving green fluorescent protein (GFP) labeled a subset of neurons including the HSNL, which suggests that sel-10 is expressed in the HSNL. sel-10 promoter driven GFP is widely expressed in body wall muscles (not consistent though), intestine(not consistent), pharynx, distal tip cell, spermatheca, and within nervous system, it is expressed in HSNs, some ventral cord neurons, a bunch of unidentified head neurons and a few tail neurons. --Pers. Comm. from Mei Ding 11-20-07.

• Primary Identifier: Expr4710
• Pattern: VNS::SYS-1 was not found in SGPs of newly hatched L1 larvae (n = 23) but was detectable ~1 h before their division (n = 48). VNS::SYS-1 was present in both nucleus and cytoplasm but was enriched in granules often localized to the proximal edge of the SGP. During the SGP division, VNS::SYS-1 localized to large puncta in each of the two daughters, at a position suggesting localization to the centrosome; no SYS-1 asymmetry was seen at this point. After the division, VNS::SYS-1 was easily seen in distal daughters but either was not seen or was barely detectable in proximal daughters. In the next division, VNS::SYS-1 was in the distal-most SGP granddaughters (Z1aa, Z4pp) but not their proximal sisters (Z1ap, Z4pa); by contrast, VNS::SYS-1 was not in SGP proximal granddaughters (Z1pa, Z1pp, Z4aa, Z4ap). VNS::SYS-1 was expressed in many cells during embryogenesis and larval development. Furthermore, SYS-1 was asymmetrically distributed in daughters of many asymmetric divisions, and SYS-1 asymmetry was the reciprocal of POP-1 asymmetry in all cases. For example, the E blastomere has lower POP-1 than the MS blastomere, but E has higher SYS-1 than MS. In addition, posterior daughters in the embryonic hypodermis and larval T cell have lower POP-1 than anterior daughters, but those posterior daughters have higher SYS-1 than anterior daughters. A similar situation holds true for distal daughters and granddaughters in the vulval lineage.
• Subcellular Localization: As seen in the SGPs, SYS-1 localized to large puncta in each daughter at a predicted centrosomal position, and in all cases, SYS-1 levels were similar at the two putative centrosomes.

• Primary Identifier: Expr4994
• Remark: Picture: Figure 1B, Figure S3A.
• Pattern: The unc-80 GFP reporter is broadly expressed in the nervous system. The reporter is expressed in both acetylcholine and GABA motor neurons as determined by double-labeling. Although expression is observed in other tissues, no expression was observed in the body muscle. unc-80 is strongly expressed in neurons. Strong expression is observed in the nervous system and in the vulval muscle. Expression was also shown in the anterior excretory canal just posterior of the head, the vulval muscle, distal tip cell of the gonad, and the anal depressor muscle in the tail.

• Primary Identifier: Expr4956
• Remark: Picture: Fig. 5, Fig 6.
• Pattern: NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.)
• Subcellular Localization: NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining.

• Primary Identifier: Expr4911
• Remark: Picture: Fig S5.
• Pattern: A transcriptional fusion of the unc-50 promoter to GFP is expressed in all cell types throughout development. unc-50::gfp expression was seen in the head of adult hermaphrodite. Expression is seen in the pharyngeal muscle, head neurons, and epidermis. Expression is also present in the gut, ventral cord motor neurons, and epidermal seam cells. In the mid body region expression is seen in the gut, seam cells, uterus, vulva muscles, and distal tip cell. In the tail region unc-50 expression can be detected in the epidermis and enteric muscles.

• Primary Identifier: Expr4350
• Pattern: Localized differently within cells and GFP fluorescence was seen in body wall muscle, distal tip cells, enteric muscle and cells of the posterior intestine. Within the pharynx, cca-1 expression is observed in most if not all pharyngeal muscle cells but is most prominent in those of the procorpus and in pm8, the most posterior cell in the terminal bulb.

• Primary Identifier: Expr4281
• Reporter Gene: [wrk-1::TM-gfp] translational fusion. wrk-1 expression was determined by means of a reporter construct (wrk1::TM::gfp), in which 4 kb of sequences upstream of the ATG start codon, all exons, and the first three introns of the wrk-1 locus were fused in frame to gfp. This construct is able to rescue the phenotype of wrk-1 mutant animals. See Transgene otEx2389. [wrk-1::gfp] transcriptional fusion in which 4 kb of sequences upstream of the ATG start codon was fused to GFP. See Transgene otEx203 [wrk-1::gfp] translational fusion. See Transgene otEx2522.
• Pattern: The wrk-1 gene is expressed in ventral midline cells, namely in the eMNs. Additional expression is observed in a subset of head neurons, including interneurons (AIY class), sensory neurons (ASI class), and head motoneurons (SMDV/D class), and glial-type sheath and socket cells. Outside the nervous system, the most prominent sites of wrk-1 expression include the intestine, excretory gland cell, distal tip cell, and coelomocytes.

• Primary Identifier: Expr4271
• Pattern: Anti-MIG-22 stained DTCs and the proximal arms of the gonad in a punctate pattern. Strong signals were detected in oocytes in adult gonads. MIG-22 was also detected in the developing vulval epithelium and seam cells. All these signals were significantly lower in mig-22(tk24) animals.

• Primary Identifier: Expr4226
• Pattern: LAG-2/Venus protein was found in DTC and also weakly in germ cells, suggesting that the fusion protein is secreted by DTC to proximal gonadal cells.

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4593
• Pattern: Transgenic animals expressing GFP under the control of the zfp-2 promoter showed fluorescence in vulval cells and all somatic gonad structures such as spermatheca, sheath cells, uterine cells and distal tip cells (DTCs).

• Primary Identifier: Expr4576
• Pattern: Examination of transgenic animals carrying a transcriptional fusion of ppn-1::GFP showed obvious expression in the DTC. Expression of ppn-1::GFP was first observed in developingembryos, localized to the primordial gonad. Embryos expressing ppn-1::GFP shows expression in the DTC precursor cells Z1 and Z4.

• Primary Identifier: Expr4661
• Pattern: CYE-1::GFP was expressed in the Z1.a/Z4.p cells before their division. Within 2 hrs after their division, the GFP signal decreased in the Z1.aa/Z4.pp but not in the Z1.ap/Z4.pa cells. Therefore, CYE-1 is expressed asymmetrically between the daughters of the Z1.a/Z4.p cells. Similar asymmetric expression was also detected using a cye-1 promoter::GFP fusion gene (cye-1p::gfp), which lacks the cye-1 coding sequence, indicating that the asymmetry is regulated at the transcriptional level.

• Primary Identifier: Expr4662
• Pattern: cki-1 expression, detected by a cki-1 promoter::GFP fusion gene, was much higher in the Z1.aa/Z4.pp cells than in the Z1.ap/Z4.pa cells.

• Primary Identifier: Expr4663
• Pattern: ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.

• Primary Identifier: Expr4547
• Reporter Gene: For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends.
• Pattern: First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery.
• Subcellular Localization: Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues.

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5139
• Remark: Strain: BC14524
• Reporter Gene: [C04C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGTTTAGATTACGACCAGGC] 3' and primer B 5' [ACTTTCTCAGAGCGATTTCGAC] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; Reproductive System; distal tip cell; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5476
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155
• Reporter Gene: [rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5460
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14164
• Reporter Gene: [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body

• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body

0 Life Stages

3 Parents

Definition	Name	Synonym	Primary Identifier
cell, posterior descendent of Z4, in hermaphrodite.	Z4.p hermaphrodite		WBbt:0007024
Posterior lobe of the bi-lobbed hermaphrodite gonad.	posterior gonad arm		WBbt:0005466
somatic gonad cell that situates at the distal tip of the hermaphrodite gonad.	hermaphrodite distal tip cell		WBbt:0006863