WormMine: AnatomyTerm WBbt:0006760

• Definition: The organ in which the eggs are developed and protected until laid.
• Name: uterus
• Primary Identifier: WBbt:0006760

4 Children

Definition	Name	Synonym	Primary Identifier
membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC.	uterine seam cell	utse	WBbt:0006789
toroidal epithelial cell that make up the bulk of the uterus, four cells anterior and four cells posterior to the vulva.	uterine toroidal epithelial cell	ut cell	WBbt:0006784
cell forming dorsal epithelium in central region of the uterus; formed by fusion of four cells.	dorsal uterine cell	du cell	WBbt:0006782
monoucleate interfacial cell between the uterus and vulva (uv1-uv3), four sets total (L/R, A/P)	uterine-vulval cell	uv cell	WBbt:0006790

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in vulva uterus, according to RNA tomography.	RNA tomography	WBPaper00055648:vulva-uterus_expressed

232 Expression Patterns

• Primary Identifier: Expr4871
• Remark: Picture: 6B, 6C.
• Pattern: GFP expression was observed in PVT. GFP was also detected in the uterine cells close to vulva.

• Primary Identifier: Expr4954
• Remark: Picture: Fig. 2.
• Pattern: In larvae and adults, the circumferential filamentous pattern did not persist, but expression was seen in a subset of head and tail socket cells, the vulva, more faintly the uterus, and the rectum.
• Subcellular Localization: GFP expression was observed in the epidermis from the 1.2-fold stage of elongation to the end of embryogenesis. The GFP formed a circumferential filamentous pattern that was spatially and temporally strikingly reminiscent of the circumferential actin microfilament pattern. Indeed, actin staining in a strain expressing the RGA-2::GFP construct showed that the two networks coincide.

• Primary Identifier: Expr4911
• Remark: Picture: Fig S5.
• Pattern: A transcriptional fusion of the unc-50 promoter to GFP is expressed in all cell types throughout development. unc-50::gfp expression was seen in the head of adult hermaphrodite. Expression is seen in the pharyngeal muscle, head neurons, and epidermis. Expression is also present in the gut, ventral cord motor neurons, and epidermal seam cells. In the mid body region expression is seen in the gut, seam cells, uterus, vulva muscles, and distal tip cell. In the tail region unc-50 expression can be detected in the epidermis and enteric muscles.

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4590
• Pattern: Promoter activity with distinct GFP expression in lateral hypodermal seam cells and in the non-seam cell hypodermis was observed throughout development. Additionally, expression was noted in many neurons, including the ventral nerve cord (VNC) and the hermaphrodite specific neuron (HSN). GFP was also observed in various somatic gonad tissues including the anchor cell in larval stages and adult vulval muscle cells, the distal tip cells, a subset of the vulval precursor cells, uterine cells, and spermatheca.

• Primary Identifier: Expr4547
• Reporter Gene: For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends.
• Pattern: First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery.
• Subcellular Localization: Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues.

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5224
• Remark: Strain: BC13518
• Reporter Gene: [C09G12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTTTTCACCAAGTTTGC] 3' and primer B 5' [TGGGCCGAGATGAGGTAG] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterus; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5153
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13956
• Reporter Gene: [pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCGTCCTTACGATCC] 3' and primer B 5' [TGAATGGTCAAAATCAGACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; uterus; body wall muscle; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5453
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11439
• Reporter Gene: [tbb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACATATCGAGGCTGAAAATC] 3' and primer B 5' [TTGCTGAAAAGGTCGTAATGAAT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5526
• Remark: Strain: BC12995
• Reporter Gene: [C47B2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATCGATGAAATGCTCAAGTTTA] 3' and primer B 5' [AATGTGGATTGTTTTAGTGGGG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; neurons along body; Larval Expression: intestine; Reproductive System; developing uterus

• Primary Identifier: Expr5334
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15046
• Reporter Gene: [rap-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGAATGGAGCATATTCTTCTG] 3' and primer B 5' [TGAACTCCCTGATTGAGAGTTTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterus; vulval muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; rectal gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5304
• Remark: Also expressed in (comments from author) : early embryo is only gut. Strain: DM12525
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterus; vulva other; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head

• Primary Identifier: Expr5080
• Remark: Strain: BC10374
• Reporter Gene: [eif-3.E::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGACATTTTCACGTTTCACGA] 3' and primer B 5' [AAACTCCAATCAATTTTCTTAACG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5043
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15504
• Reporter Gene: [ntl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCTCGAACCCCATT] 3' and primer B 5' [GTCGTCTGCTAAGATCTGCAATAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5002
• Remark: Strain: BC11357
• Reporter Gene: [soc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACGTCTCCGTGATCCAT] 3' and primer B 5' [CGCAGCCTTCAGACACAGT] 3'.
• Pattern: Adult Expression: intestine; rectal epithelium; Reproductive System; uterus; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr5099
• Remark: Also expressed in (comments from author) : quite a number of processes in head Strain: BC10874
• Reporter Gene: [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells

• Primary Identifier: Expr11300
• Pattern: Strong expression at all stages (starting in the embryo), vulval epithelium, spermatheca, uterus, arcade cells?, CEPsh?, several unidentified head cells

• Primary Identifier: Expr9674
• Pattern: Pprkl-1::GFP was only consistently detected in VC1-6 and the HSN neurons and a small subset of neurons in the head and ventral nerve cord. In non-neuronal tissue, prkl-1 promoter activity was detected in somatic gonad cells, uterine cells, distal tip cells, and vulval cells.

• Primary Identifier: Expr16432
• Pattern: We detected DMD-9::GFP expression in 10 head neurons of hermaphrodites at the L4 stage. High dmd-9 expression was detected in the BAG, AFD, AWCon, AWCoff, ASEL, and AWB neurons, with lower expression in ASER, and the ASGs. We also observed weak and inconsistent expression in other head neurons and transient weak expression in the tail of hermaphrodites and males at the L4 stage. No overt differences were observed in DMD-9::GFP expression in neurons of hermaphrodites and males. We also detected DMD-9::GFP expression in non-neuronal tissues. Transient DMD-9::GFP expression was observed in the uterine cells at specific sub-stages of the L4 stage. DMD-9 is not expressed from L4.0 to L4.3, with expression first detected in the early L4.4 stage, with the highest level during L4.4. before gradual loss by the L4.9 stage (Mok et al. 2015). DMD-9::GFP was not detected in adult uterine cells. We also detected DMD-9::GFP expression in sperm of hermaphrodites and males. In addition, we found that in a small proportion of L4 animals DMD-9::GFP shows asymmetric expression in the ASEs and AWCs neurons.

• Primary Identifier: Expr11620
• Pattern: pfln-1::GFP expression begins in early L4 stage and continues through adulthood in the uterus, spermatheca, and proximal gonadal sheath. In addition to the somatic gonad, weak and variable GFP expression is evident in the posterior intestinal cells, anal depressor muscle, unidentified neurons, and the pharynx. Due to silencing of repetitive extrachromosomal arrays in the germline, we cannot exclude the possibility that fln-1 is also expressed in the germline.

• Primary Identifier: Expr11621
• Subcellular Localization: GFP::FLN-1A localizes to actin filaments in the spermathecal and uterine cells.

• Primary Identifier: Expr9643
• Pattern: Analysis of GFP reporter constructs suggests fln-1a, and likely fln-1b, are predominantly expressed in the somatic gonad, including the spermatheca, sheath, and uterus. In contrast, the fln-1c construct is expressed in the body wall muscle, vulval muscle and hypodermis.

• Primary Identifier: Expr5679
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14696
• Reporter Gene: [F08C6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATCAACTCGAAGCATATTGA] 3' and primer B 5' [CGAGGGATTATTTGTGCTGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5633
• Remark: Also expressed in (comments from author) : the pharyngeal bulbs express but not the isthmus Strain: BC11352
• Reporter Gene: [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; vulval muscle; spermatheca; head mesodermal cell; unidentified cells in head; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; developing spermatheca; head mesodermal cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5624
• Remark: Also expressed in (comments from author) : unidentified cells in tail, possibly neural Strain: BC13363
• Reporter Gene: [elo-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCTGCCATTGCAAACAGTC] 3' and primer B 5' [TCGTATTTTGCGATTTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; body wall muscle; hypodermis; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; hypodermis; unidentified cells in tail

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch.		L4 larva Ce	WBls:0000038
	The stage after an hermaphrodite animal is fully-developed and reaches maturity.		adult hermaphrodite Ce	WBls:0000057

3 Parents

Definition	Name	Synonym	Primary Identifier
organ in hermaphrodite animal that produces both ova and sperm.	hermaphrodite gonad	ovotestis	WBbt:0005178
Association of cells with a common embryological origin or pathway and similar structure and function. Usually, cells of a tissue are contiguous at cell membranes and may be of one or more types. Tissues aggregate to form organs.	Tissue		WBbt:0005729
An apparatus for laying eggs of the hermaphrodite reproductive system, consists of the uterus, the uterine muscles, the vulva, the vulval muscles, and a local neuropil formed by the egg-laying neurons.	egg-laying apparatus		WBbt:0008587