WormMine: AnatomyTerm WBbt:0005105

• Definition: The left and right lateral ganglia lie beside the nerve ring in the head. They each contain about (30) neuron cell bodies and send their neuronal processes into the ring at its posterior margin either laterally or ventrally via the amphid commissures and ventral ganglion, but form no local neuropil separate from the nerve ring. The lateral ganglia are in close contact with the lateral hypodermal cords.
• Name: lateral ganglion
• Primary Identifier: WBbt:0005105
• Synonym: lateral ganglia

2 Children

Definition	Name	Synonym	Primary Identifier
lateral ganglion on the right side.	lateral ganglion right		WBbt:0005101
lateral ganglion on the left side.	lateral ganglion left		WBbt:0005103

0 Expression Clusters

36 Expression Patterns

• Primary Identifier: Expr4592
• Pattern: The full-length dyf-5::gfp construct (see Expr4591) showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail. The dyf-5ex4::gfp fusion construct essentially showed the same dyf-5 expression pattern, albeit stronger and more restricted to the cell bodies. In addition, DYF-5ex4::GFP could be detected in the CAN cells, neurons associated with the excretory canal and in a pair of neurons in the posterior lateral ganglion.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr12719
• Pattern: acc-1 and acc-2 fosmid reporters show very restricted and non-overlapping expression in the adult nervous system. The acc-1 fosmid reporter is expressed in a subset of cholinergic neurons, including cholinergic neurons in the ventral nerve cord, the retrovesicular ganglion and a few head neurons (including the SMD, RMD motor neurons, the AVA and AVE command interneurons and the SAA neurons). A small number of glutamatergic neurons also express acc-1 (including the pharyngeal neurons MI and M3, the PLM neurons and an unidentified neuronal pair in the lateral ganglion).

• Primary Identifier: Expr1167
• Pattern: Neurons in anterior, lateral, lumbar ganglia; pharyngeal motorneurons and interneurons; pharynx.

• Primary Identifier: Expr1170
• Pattern: Neurons in anterior, lateral, lumbar ganglia; pharyngeal motorneurons and interneurons; pharynx; intestine.

• Primary Identifier: Expr720
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Prominent staining of the entire nervous system, specially the axonal processes emanating from neuronal cell bodies is observed at all developmental stages. Neuronal processes including axonal and dendrites consistently stains brighter than the cell bodies. Staining is detected in the central neurophil (nerve ring) in the head, the ventral cord consisting of motor neurons along the body length, lateral nerve cords, lumbar commissures and neuronal cell bodies in the tail ganglia. Staining is observed in the six sets of touch receptor neurons ALML, ALMR, PLML, PLMR, AVM and PVM. In the head region, neurons and their axonal and dendritic processes in the anterior ganglia, lateral ganglia, ventral ganglion, retro-vesicular ganglion and the nerve ring consisting of axonal fibres from neurons located in the head and tail ganglia are brightly labeled. Neurons and their axonal processes are stained in the tail, which has a pair of bilaterally symmetric lumbar ganglia, a small dorso-rectal ganglion and the pre-anal ganglion at the posterior end of the ventral cord. Besides the major axonal bundle of the ventral nerve cord, the dorsal nerve cord and a set of lateral cords along the body length are also stained. Muscle cells, intestine and hypodermal cells stain weakly. Staining of the mitotic spindles in C. elegans are clearly visible in embryos and meiotic spindles in the germline cells in the gonad of adult hermaphrodites. Spindles are stained more strongly and non-spindle structures.
• Subcellular Localization: Stained in neuronal processes and cell bodies. Spindles are stained more strongly.

• Primary Identifier: Expr946
• Remark: To compare the transcription pattern of the daf-1 promoter with the whole gene, the gfp cDNA was fused to the terminus of the daf-1 gene in a plasmid that included 2.6 kb of upstream sequence. Despite the fact that this transgene rescued the daf-1 Daf-c mutant phenotype, GFP fluorescence was not detected in rescued animals. Hence, these observations were limited to the daf-1 promoter fusion, which may not represent the expression pattern of the whole daf-1 gene if enhancer elements are present in introns or in 3' sequences.
• Pattern: GFP expression was observed in the head and the developing ventral nerve cord beginning in mid-stage embryos and continuing into adulthood. In the head, GFP was detected in more than twenty neurons in the anterior, lateral, ventral and retrovesicular ganglia. Fluorescent processes terminating at the tip of the head suggest that daf-1 is expressed in sensory neurons and in support cells in the amphids and inner labial sensilla. In the midbody, GFP was expressed in the ALM mechanosensory neurons and the PVT neuron, as well as one additional neuron pair. In the lumbar ganglia of the tail, five cells expressing GFP included phasmid neurons and PLN and PLM mechanosensory neurons. The daf-1 promoter also conferred gfp expression in nonneuronal cells, including a membranous sheath surrounding the distal end of the intestine and in the distal tip cell (DTC) of the gonad. In some lines, GFP was sometimes detected in the muscles of L4 and adult animals. In L1 larvae, daf-1 promoters is active in neurons in the head, as well as in the ventral cord and tail. The promoter continues to express GFP in dauer larvae from starved plates.

• Primary Identifier: Expr859
• Pattern: cle-1AGFP expression was first detected in comma stage ( 390min) embryos in cephalic neurons. Expression in interneurons and rectal epithelial cells is seen by the 2-fold stage, 60 min later, and continues through larval and adult stages. cle-1BGFP expression was first observed at the 3-fold stage ( 520 min) of embryogenesis in four neurons of the lateral ganglia and in the DD dorsal motorneurons. The postembryonic VD dorsal motorneurons also express cle-1BGFP starting in the second larval stage, and this pattern persists through larval and adult stages. cle-1CGFP expression is first seen in comma stage embryos in pharynx and body wall muscles and later appears in the canal-associated neurons (CAN), head mesodermal cell, accessory muscles, and intestine. During larval development, expression is restricted to the ventral GLR glia like cells, the canal-associated neurons, and the head mesodermal cell. Beginning in the late fourth larval stage and continuing through adult, cle-1CGFP expression appears in somatic sheath cells of the gonad and reappears in body wall muscles.

• Primary Identifier: Expr948
• Remark: GFP expression matched the expression pattern of a daf-4::gfp gene fusion (Patterson et al., 1997), suggesting that daf-4 regulatory sequences conferring tissue-specificity are upstream of the transcription start site.
• Pattern: GFP was expressed in the pharynx, intestine, hypodermis and body wall muscles, in L1 through adult stages. In the head, GFP was seen in neurons of the lateral, vesicular and retrovesicular ganglia. Ventral cord neurons also were visible, as was the PVT neuron, but only two phasmid neurons were detected in the tail. Whereas the nervous system is the primary site of gfp expression mediated by the daf-1 promoter, the daf-4 promoter directs expression more broadly, consistent with its other functions. In L1 larvae, when the dauer/nondauer decision is made, daf-4 promoter is active in neurons in the head, as well as in the ventral cord and tail. The promoters continues to express GFP in dauer larvae from starved plates.

• Primary Identifier: Expr15
• Remark: life_stage summary : postembryonic
• Pattern: Expression is seen in 4 neural cells of the anterior ganglion, 8 more in the lateral/ventral ganglia, and 4-6 nuclei of the tail ganglia. Staining is also seen on sub-cellular particles in the vm1 muscles of the vulva. The neural pattern develops from L1 onwards; the vulval staining occurs L4 onwards.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr18
• Remark: life_stage summary : post L2 life_stage summary = post L1 or post L2
• Pattern: Earliest expression is seen from L1 stage. It is seen in three neurons in the head ganglia. Nuclei of the lateral/ventral ganglia show expression from L2/3 onwards. Further staining of 3 cells, possibly in the tail ganglia, develops in adult worms along with a few nuclei in the ventral cord. Cytoplasmic staining of the neural processes in the ventral nerve cord occurs as well. nuclei of the lateral/ventral ganglia show expression from L2/3 onwards. Further staining of 3 cells, possibly in the tail ganglia, develops in adult worms along with a few nuclei in the ventral cord.

• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones

• Primary Identifier: Expr3065
• Subcellular Localization: Anti-GPA-2 antibodies stained many cilia, cell bodies, and axons in the head. Two cell bodies in the anterior ganglion, two pharyngeal muscle cells, and seven cell bodies in the lateral and ventral ganglia showed staining, indicating that GPA-2 is expressed in more cells than initially identified. Importantly, in addition to rod-like cilia, the typical wing shape of the AWC cilia could be distinguished at high magnification. This confirms that GPA-2 is expressed in the AWC cells. No indications of GPA-2 expression in the AWA cells was found.

• Primary Identifier: Expr1773
• Pattern: kin-29::GFP expression was primarily neuronal, with additional expression in body wall muscle and hypodermal cells. Expression persisted through all stages of postembryonic development. Among neuronal cells, kin-29 was expressed in multiple sensory neurons and interneurons in the lateral, anterior, and lumbar ganglia, as well as in motor neurons in the ventral motor cord. kin-29::GFP colocalizes with odr-1::RFP expression in both the AWB and AWC olfactory neurons. kin-29 was also expressed in the ASH, AFD, ASJ, AWA, ASK, ASG, and ASI sensory neurons. In addition, kin-29 was expressed in the AIY and AIZ interneurons. Additional kin-29-expressing cells were not identified definitively.
• Subcellular Localization: KIN-29::GFP was localized cytoplasmically, and was excluded from the nuclei of most, if not all, cell types. KIN-29::GFP was localized cytoplasmically at all stages of development examined, including in dauer larvae. However, KIN-29::GFP was rapidly translocated to the nucleus upon heat shock, but not upon starvation for 18 hr, addition of dauer pheromone, or in a tph-1 mutant background, although transient nuclear localization in a subset of cell types cannot be ruled out. Heat shock-induced translocation was observed in most, if not all cells, including neurons, muscles, and hypodermal cells. Translocation was reversible; KIN-29::GFP was relocalized to the cytoplasm within an hour upon temperature downshift.

• Primary Identifier: Expr12869
• Pattern: qui-1::GFP was visible in the processes of the nerve ring and in several neurons of the lateral and ventral ganglia, including the avoidance sensory neurons ASH and ADL. GFP expression was not detected in ASK sensory neurons. Four additional neurons in the retrovesicular ganglion and two neurons in the lumbar ganglion, PVQ and the sensory neuron PHB, also express GFP. This expression pattern partially overlaps but is not completely coincident with that obtained with a much shorter construct in which GFP was fused to the second exon, and the construct was thus missing part of exon 2 and the last 17 introns and exons of the gene (not shown). Expression from this shorter construct included neither ASH nor PHB, indicating that important regulatory elements are present within the coding region of qui-1.
• Subcellular Localization: In the ASH sensory neurons, the reporter protein uniformly stained the cell body, nucleus, dendrite and axon. The staining was too faint to unambiguously determine whether QUI-1::GFP localized also in the cilia. In most of the other neurons, expression of GFP was lower in all cellular compartments and apparently absent from the nucleus.

• Primary Identifier: Expr14129
• Pattern: ASK, ASI, at least one more sensory neuron pair in lateral ganglion, IL2s, PVT, phasmids (dim, not very consistent)

• Primary Identifier: Expr1704
• Remark: Transgenic lines were generated by coinjection of the nlp::gfp construct (5070 ng/ul) and lin-15 rescue construct (pJM24,100 ng/ul) into lin-15(n765ts) animals. At least two independent transgenic lines were analyzed for each nlp gene; 510 animals were scored per line. 1,1'-Dioctadecyl-3,3,3',3 -tetramethylindodicarbocyanine perchlorate (Molecular Probes) was used to stain amphid and phasmid neurons to facilitate identification.
• Pattern: Expressed in ASK, ADL, CAN, 2 lateral neurons, 1 tail and 1 male tail neuron, 2 ant. pharyngeal neurons.

• Primary Identifier: Expr967
• Remark: An independently isolated integrant (saIs11) carrying a construct without the NLS expressed GFP in the intestine and small cells in the head and tail regions. The authors noted that these small cells could not be identified reliably.
• Pattern: GFP fluorescence was observed from the embryo to the adult in a complex and dynamic pattern. Cells that consistently expressed DAF-14::GFP included intestinal cells, lateral hypodermal cells, the anal sphincter muscle, phasmid sheath cells, neurons in the lateral ganglia, the excretory duct cell, and several small cells anterior of the nerve ring that were not identified. In the lateral ganglia, expression was prominent in only a subset of neurons. In particular, strongest expression was often seen in an unidentified interneuron pair in the vicinity of AVJ and RIV.

• Primary Identifier: Expr1632
• Pattern: Although the antibody and reporter patterns coincide in a number of key aspects, a few differences are evident. Expression in the head hypodermal cells upon hatching is only faintly detected with the gfp reporter construct. Moreover, only a few neurons in the head express the ceh-32::gfp construct, compared with the immunostaining results. These differences could reflect that positive control elements are missing or inactive in the reporter transgenes. The expression of ceh-32 begins during the embryonic development, during the gastrulation stage (in 100-min-old embryos), and persists until adults. Embryonic expression of ceh-32 is detected in the anterior part of the embryos in head hypodermal and neuronal precursor cells. Upon hatching, ceh-32 is expressed in the hypodermal and neuronal cells of the head as well as in the somatic gonad. The head hypodermal nuclei expressing CEH-32 were identified as the nuclei of hyp3, hyp4, hyp5, and the first ventral nuclei of hyp6. In the head neurons, ceh-32 is found expressed in 12 cells of the anterior ganglion, in the sensory neurons ADL, in a pair of neurons in the dorsal side of lateral and ventral ganglion, and in 8 neurons in the ventral side of the lateral and ventral ganglion. Some weakly expressing cells were not identified. In the somatic gonad, the expression of ceh-32 begins at the L1/L2 stage in the sheath/spermatheca (SS) precursor cells, and this expression is maintained during the development of the somatic gonad in the gonadal sheath cells. In the adult worm, all the gonadal sheath cells express ceh-32.
• Subcellular Localization: The CEH-32 protein is detected exclusively in the nuclei.

• Primary Identifier: Expr15501
• Pattern: Though the tag-63 reporter occasionally reveals faint expression in gonads and intestines, we mostly detected strong expression in neurons such as body, head and tail neurons. In detail, we identified significant expression in sublateral neurons, CANL/ CANR neurons, nerve ring and amphid neurons, ventral cord neurons, tail neurons, and mechanosensory neurons such as ALM. In many of these neurons TAG-63 colocalizes with (neuron-specific kinesin-3) UNC-104 and (synaptic precursor) SNB-1 proteins.

• Primary Identifier: Expr13359
• Pattern: skn-1::EGFP is highly expressed in neurons in the lateral, ventral and dorsal ganglia, and to a lesser extent in the anterior ganglia. Furthermore, skn-1::EGFP clearly colocalizes with the specific AIY marker ttx-3::RFP, confirming that skn-1 is indeed expressed in AIY interneurons.

• Primary Identifier: Expr8865
• Remark: Picture: Fig 5.
• Pattern: GFP::RSBP-1 was expressed throughout the C. elegans nervous system and in many muscles. Expression of GFP::RSBP-1 was observed in neuronal cell bodies in the head, in the bundle of neuronal processes that form the nerve ring and in the neurons and muscles of the pharynx; in neuronal cell bodies and the anal depressor muscle in the tail; in the cell bodies and processes of the ventral nerve cord and in body wall muscles, which are required for locomotion; in the hermaphrodite specific neuron (HSN) and the vulval and uterine muscles that are required for egg laying; as well as in lateral neurons, the dorsal nerve cord, commissural nerve processes and additional muscles and support cells in the head.

• Primary Identifier: Expr8536
• Remark: Picture: Fig. 2A,B.
• Subcellular Localization: The commissures of all inhibitory motor neurons, including their characteristic branches in the sublateral nerve cords, were strongly stained; often the cell bodies of the inhibitory motor neurons were also stained. In the head ganglia there was staining of the same neurons that had previously been found to contain GLI -namely, four neurons in the nerve ring (the RME-like cells)-and staining of three or four more pairs of cells in the ventral and lateral ganglia. In the tail ganglia, two neurons were stained (the DVB-like cell and a neuron in the preanal ganglion).

• Primary Identifier: Expr1012
• Pattern: Reporter construct is expressed primarily or exclusively in neurons or "endocrine/secretory" cells. GFP expression in non-neuronal tissues include the gut (frequently), specific somatic gonad cells, and in pharyngeal or vulval muscles (rarely). No expression is detected in hypodermal, body wall muscle or germ tissues. nlp-1::GFP is expressed in at least 5 classes of neurons located in the head and at least 1 class in the tail. nlp-1 expressed in PHB, lateral neurons and head neurons,

• Primary Identifier: Expr2246
• Pattern: In general, the expression patterns found for the translational fusion constructs were similar to those reported above for the transcriptional fusions. Cells were labeled in the anterior, lateral and ventral, and retrovesicular ganglion near the pharynx, in the ventral nerve cord, and in the pre-anal, dorso-rectal, and lumbar ganglion near the tail. Animals demonstrated labeling of the lumbar ganglion in an adult animal. HSN (hermaphrodite-specific neuron) was also labeled as were the vulC cells of the vulva and the excretory cell.
• Subcellular Localization: NHX-5 appeared to be associated with intracellular membranes. NHX-5::GFP expression occurred primarily in neuronal cell bodies. Labeling was granular in the cytoplasm and extended weakly through the neuronal cell processes.

• Primary Identifier: Expr13203
• Pattern: Three rectal glands; Faint expression in head and tail neurons: at least 6 neurons in the lumbar ganglion, at least 20 neurons in the anterior ganglion, at least 20 neurons in the lateral ganglia, 2 neurons in the dorsorectal ganglion.

• Primary Identifier: Expr1689
• Remark: Transgenic lines were generated by coinjection of the nlp::gfp construct (5070 ng/ul) and lin-15 rescue construct (pJM24,100 ng/ul) into lin-15(n765ts) animals. At least two independent transgenic lines were analyzed for each nlp gene; 510 animals were scored per line. 1,1'-Dioctadecyl-3,3,3',3 -tetramethylindodicarbocyanine perchlorate (Molecular Probes) was used to stain amphid and phasmid neurons to facilitate identification.
• Pattern: Expressed in 7 head neurons, 1 lateral neuron, intestine.

• Primary Identifier: Expr3123
• Pattern: Animals transformed with mfb-1p::gfp exhibit GFP fluorescence in the late embryo and through the larval and adult stages, strong expression in the head and tail ganglia, the ventral nerve cord, the tail hypodermal cells and the intestine, weak expression in some lateral neurones, seam cells and body wall muscles in some lines, and no expression in the pharynx and distal tip cells. MFB-1::GFP was prominently detected in some head and tail ganglia, weakly in the ventral nerve cord, but little or not at all in the hypodermis, intestine, seam cells and muscles.
• Subcellular Localization: In the head and tail ganglia, MFB-1::GFP was preferentially localized to the nuclei.

• Primary Identifier: Expr13205
• Pattern: Intestine; Body wall muscles; Pharynx muscles; Neurons: at least 12 pairs of neurons in the head lateral ganglia, 5 pairs of post- anal neurons, PDB, ventral nerve cord motor neurons.

• Primary Identifier: Expr1182
• Pattern: Neurons in anterior, lateral, retrovesicular ganglia; seam cells.

• Primary Identifier: Expr3394
• Remark: Reporter gene fusion type not specified.
• Pattern: In transgenic animals expressing the UNC-63::GFP fusion protein fluorescence was observed in all body wall muscles and in vulval muscles. Expression was also detected in many cells of the nervous system, including motor neurons in the ventral nerve cord (AS, DA, DB, which innervate dorsal muscles; VB, VD and DB, which innervate ventral muscles; VC which innervates vulval and ventral muscles) and neurons in the head, posterior lateral, pre-anal, and lumbar ganglia. No expression is observed either in the sphincter muscle cell or in the anal depressor muscle.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
ganglion in the head.	head ganglion		WBbt:0005135