WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5715 Remark  Also expressed in (comments from author) : embryo expression only Strain: BC14208
Reporter Gene  [sod-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAGGAATTGCCGTTTTTACAACT] 3' and primer B 5' [TTTTCGGCTGCAAATAATTAAAA] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004931 sod-2 F10D11.1 Caenorhabditis elegans

0 Life Stages