WormMine: ExpressionPattern Expr10014

• Pattern: ChUP-1 expression was detected in all developmental stages by RT-PCR and no differences were detected in mRNA levels. The ChUP-1::GFP signal was especially strong all along the worm intestine. The pharynx also showed GFP signal, especially at the terminal bulb and presumably, the excretory gland cells. Although fluorescence was not as strong as that observed in other structures, GFP was also observed in embryos.
• Primary Identifier: Expr10014
• Remark: The authors have changed the name of the protein described in the paper from CUP-1 to ChUP-1, given that CUP-1 was already taken by a family of genes with unknown function.
• Reporter Gene: [ChUP-1::GFP] translational fusion. ChUP-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction. [chup-1::GFP] translational fusion. chup-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction.
• Subcellular Localization: The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4- 64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, inmmunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92). The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4-64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, immunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92).

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct.	excretory gland cell	exc gl	WBbt:0005776
the last, posterior bulb of the pharynx.	terminal bulb		WBbt:0003732
cell that exists in and is part of an embryo.	embryonic cell		WBbt:0007028

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00006477	chup-1	ZK721.1	Caenorhabditis elegans

6 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The second stage larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch.		L2 larva Ce	WBls:0000027
	The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch.		L4 larva Ce	WBls:0000038
	The first stage larva. At 25 Centigrade, it ranges 14-25.5 hours after fertilization, 0-11.5 hours after hatch.		L1 larva Ce	WBls:0000024
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	The third stage larva. At 25 Centigrade, it ranges 32.5-40 hours after fertilization, 18.5-26 hours after hatch.		L3 larva Ce	WBls:0000035
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003