WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000105 Gene Name  alg-1
Sequence Name  ? F48F7.1 Brief Description  alg-1 encodes an Argonaut ortholog; alg-1 is involved in RNA interference and affects developmental timing along with alg-2 and dcr-1 by regulating expression of the lin-4 and let-7 small temporal RNAs.
Organism  Caenorhabditis elegans Automated Description  Enables RNA binding activity and RNA endonuclease activity. Involved in several processes, including regulation of development, heterochronic; regulatory ncRNA-mediated gene silencing; and vulval development. Located in P-body. Part of RISC complex. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; gonad; somatic cell; and tail. Human ortholog(s) of this gene implicated in alcohol dependence and glaucoma. Is an ortholog of human AGO2 (argonaute RISC catalytic component 2).
Biotype  SO:0001217 Genetic Position  X :15.8406 ±0.103552
Length (nt)  ? 7152
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000105

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F48F7.1a.2 F48F7.1a.2 5005   X: 13949110-13956261
Transcript:F48F7.1b.1 F48F7.1b.1 3072   X: 13949489-13954707
Transcript:F48F7.1a.3 F48F7.1a.3 6283   X: 13949571-13956261
Transcript:F48F7.1a.1 F48F7.1a.1 4592   X: 13951262-13956261
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F48F7.1a F48F7.1a 3009   X: 13951291-13951500
CDS:F48F7.1b F48F7.1b 3072   X: 13949489-13949522

45 RNAi Result

WormBase ID
WBRNAi00095627
WBRNAi00087447
WBRNAi00065485
WBRNAi00047761
WBRNAi00008819
WBRNAi00025553
WBRNAi00066792
WBRNAi00094027
WBRNAi00094535
WBRNAi00094536
WBRNAi00064859
WBRNAi00097789
WBRNAi00097788
WBRNAi00087452
WBRNAi00080900
WBRNAi00065493
WBRNAi00086723
WBRNAi00086730
WBRNAi00093821
WBRNAi00093811
WBRNAi00093774
WBRNAi00093729
WBRNAi00094534
WBRNAi00084646
WBRNAi00070057
WBRNAi00080904
WBRNAi00080903
WBRNAi00080906
WBRNAi00080908
WBRNAi00080910

138 Allele

Public Name
gk964260
gk964029
gk962707
gk964028
gk963810
gk963581
gk299859
gk299860
gk299861
gk299862
gk299857
gk299858
gk299863
gk299864
gk299865
gk299866
gk299870
gk299871
gk299872
gk299873
gk299867
gk299868
gk299869
gk299874
gk299875
gk299852
gk299853
gk299854
gk299855
gk299856

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000105 13949110 13956261 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_13956262..13960148   3887 X: 13956262-13960148 Caenorhabditis elegans

184 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA. Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference. WBPaper00045974:NSM_enriched_totalRNA_RNAseq
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts expressed in vulva. FPKM >= 1. WBPaper00064122:vulva_transcriptome
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Expression Pattern Group C, enriched for genes involved in metabolic processes. The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. WBPaper00036286:Pattern_C
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT

22 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Reporter gene fusion type not specified.   Expr4609 Expressed in the cytoplasm from early embryogenesis to adulthood in most, if not all, cells in C. elegans. There is no clear difference in the expression patterns of alg-1 and alg-2.  
    Expr2009288 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. Strain: BC12839 [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'. Expr6117 Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Unsure if detecting hypodermis or not. Strain: BC12655 [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'. Expr6118 Adult Expression: pharynx; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; Nervous System; head neurons; unidentified cells in tail ;  
Strain: BC12895 [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'. Expr6116 Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; seam cells; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; seam cells; Nervous System; head neurons;  
    Expr1030054 Tiling arrays expression graphs  
    Expr16401    
Picture: Fig. 1.   Expr8653 Expressed throughout the animal, initiating expression in early embryos, and acculminating in the adult with intense expression in the pharynx, seam cells, distal tip cells (DTCs), somatic gonad and vulval precursor cells (VPCs), vulva and spermatheca. The GFP::ALG-1 protein is localized in the cytoplasm and can be detected highly concentrated in subcellular granules.
    Expr10010 ALG-1 was prominently expressed in the pharynx. Cells in the tail also displayed specific expression. Expression was seen in vulva, seam cells, ventral nerve chord and somatic gonad. The endogenous ALG-1 expression was confirmed for the pharynx and head neurons with a polyclonal antibody raised against the ALG-1 specific N-terminus region. Examination of the ALG-1 expression during larval development did not reveal differences in expression during the four larval stages and adults. During embryogenesis ALG-1 is first detected at the beginning of the morphogenetic phase.  
    Expr1151594 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr9968 RFP::ALG-1 is expressed in DTC and sheath cells besides other somatic tissues (AVR, unpublished data).  
    Expr13805 ALG-1 and ALG-2 were expressed in most somatic cells but exhibited some tissue specificity in the head region. Pharyngeal cells predominantly expressed GFP::ALG-1, while certain head neurons adjacent to the pharynx were enriched for RFP::ALG-2. Consistent with the Western blot results, there was a global decline in expression of GFP:: ALG-1 but not RFP::ALG-2 as the animals aged.  
    Expr9967 By immunostaining of extruded gonads using a newly generated ALG-1-specific antibody, we observed that ALG-1 is localized to the DTC of the wild-type gonads but not in alg-1(gk214).  
Original chronogram file: chronogram.1445.xml [F48F7.1:gfp] transcriptional fusion. Chronogram436    
Original chronogram file: chronogram.1432.xml [F48F7.1:gfp] transcriptional fusion. Chronogram422    
    Expr2027525 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr10994   The translational fusion reporter for gfp::alg-1 was diffusely expressed in the cytoplasm of most embryonic cells.
CRISPR allele name not provided   Expr15816   In wild- type animals, GFP::ALG-1 is localized broadly across the cytoplasm of the cell.
    Expr13804 While ALG-2 levels remained relatively constant from the fourth larval stage (L4) through day 11 of adulthood, ALG-1 levels decreased precipitously during adulthood.  
Original chronogram file: chronogram.365.xml [F48F7.1:gfp] transcriptional fusion. Chronogram1490    
    Expr14720 HA::ALG-1 was abundant throughout development, consistent with a central role for ALG-1 in the miRNA pathway.  
    Expr1013052 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

26 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  part_of
  located_in
  part_of

16 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000105 13949110 13956261 1

26 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  part_of
  located_in
  part_of

12 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Transcripts that showed significantly decreased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_downregulated
  Genes upregulated by alg-1(-). t-statistic difference of > 2.5 with p < 0.01. WBPaper00035588:alg-1(-)_upregulated
  Transcripts that showed significantly increased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites. DESeq, fold change > 2, adjusted p-value < 0.05. WBPaper00054758:alg-1(gk204)_upregulated
  Genes down regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_downregulated
  Transcripts that showed significantly decreased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites. DESeq, fold change > 2, adjusted p-value < 0.05. WBPaper00054758:alg-1(gk204)_downregulated
  Genes with expression level up in alg-1 mutant background. Sets of probesets with up- or down-regulated expression in the mutants relative to WT were determined via t test (two-tailed, homoscedastic) with a P value cutoff of 0.01, requiring in addition an average expression difference of 1.5 or greater on the natural scale. WBPaper00032425:up_in_alg-1
  Genes with expression level down in alg-1 mutant background. Sets of probesets with up- or down-regulated expression in the mutants relative to WT were determined via t test (two-tailed, homoscedastic) with a P value cutoff of 0.01, requiring in addition an average expression difference of 1.5 or greater on the natural scale. WBPaper00032425:down_in_alg-1
  MicroRNAs that showed significantly decreased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_downregulated_miRNA
  MicroRNAs that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated_miRNA
  Proteins identified by immunoprecipitation with GFP-ALG-1 using anit-GFP antibody, SDS-PAGE and Mass Spectrometry. N.A. WBPaper00034755:ALG-1_interacting

1 Sequence

Length
7152

1 Sequence Ontology Term

Identifier Name Description
gene  

11 Strains

WormBase ID
WBStrain00029030
WBStrain00030779
WBStrain00030775
WBStrain00030776
WBStrain00033317
WBStrain00035775
WBStrain00054820
WBStrain00055669
WBStrain00002385
WBStrain00002354
WBStrain00002241

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_13945764..13949109   3346 X: 13945764-13949109 Caenorhabditis elegans