WormMine: Gene WBGene00002251

• WormBase Gene ID: WBGene00002251
• Gene Name: lat-1
• Sequence Name: B0457.1
• Brief Description: lat-1 encodes a seven transmembrane domain receptor that is a member of the adhesion class of G protein-couple receptors (aGPRCs) and the nematode homolog of Latrophilin/CIRL/LPHN/CL; lat-1 is required for embryonic elongation, pharyngeal development, and sperm development and/or function; LAT-1 is expressed in developing epithelia, specifically in left epidermoblasts during dorsal intercalation, and also in pharyngeal muscles and neurons, and in the nerve ring; LAT-1 localizes to the plasma membrane; in the embryo, lat-1 expression overlaps with that of ten-1 in the dorsal left epidermoblasts; as lat-1 and ten-1 also display genetic interactions during embryonic development, the overlapping expression patterns suggest that these two genes have overlapping functions during embryogenesis.
• Organism: Caenorhabditis elegans
• Automated Description: Enables endopeptidase activity. Involved in several processes, including anterior/posterior pattern specification; embryo development; and self proteolysis. Located in plasma membrane. Expressed in several structures, including ABarppaapa; AIY; Caaaaa; Caaaap; and pharynx. Is an ortholog of human ADGRL3 (adhesion G protein-coupled receptor L3).
• Biotype: SO:0001217
• Genetic Position: II :0.926689 ±0.001562
• Length (nt): 11794

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002251

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0457.1a.1	B0457.1a.1	3618	II: 8896841-8908633
Transcript:B0457.1b.1	B0457.1b.1	3613	II: 8896841-8908634
Transcript:B0457.1c.1	B0457.1c.1	480	II: 8896879-8904109

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0457.1a	B0457.1a	3045	II: 8896879-8896987
CDS:B0457.1b	B0457.1b	3039	II: 8896879-8896987
CDS:B0457.1c	B0457.1c	345	II: 8896879-8896987

11 RNAi Result

• WBRNAi00063114
• WBRNAi00063113
• WBRNAi00117271
• WBRNAi00117272
• WBRNAi00039076
• WBRNAi00038541
• WBRNAi00009789
• WBRNAi00061066
• WBRNAi00028153
• WBRNAi00117270
• WBRNAi00117269

163 Allele

• gk963801
• gk963053
• gk962682
• gk962798
• gk964215
• gk149794
• gk149793
• gk5420
• WBVar01696037
• WBVar01696038
• WBVar01696039
• WBVar01696040
• WBVar01438928
• WBVar01376800
• WBVar01376811
• h8474
• h15123
• h8293
• WBVar01784283
• WBVar01784284
• ok1465
• gk957663
• WBVar00104719
• WBVar01666318
• gk957664
• WBVar00104718
• WBVar01666317
• WBVar01666320
• WBVar00104720
• WBVar01666319

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002251
• Start: 8896841
• End: 8908634
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8908635..8909007
• Length (nt): 373
• Chromosome Location: II: 8908635-8909007
• Organism: Caenorhabditis elegans

176 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

15 Expression Patterns

• Primary Identifier: Expr5075
• Remark: Strain: BC11510
• Reporter Gene: [lat-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCTGCCATACTGAAGGC] 3' and primer B 5' [TACGTCGGATCAGTGCATACTATT] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulva other; spermatheca; hypodermis; Nervous System; head neurons; neurons along body; tail neurons; Embryo Expression: body wall muscle; hypodermis; Larval Expression: intestine; Reproductive System; distal tip cell; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5074
• Remark: Strain: BC10411
• Reporter Gene: [lat-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCTGCCATACTGAAGGC] 3' and primer B 5' [TACGTCGGATCAGTGCATACTATT] 3'.
• Pattern: Larval Expression: intestine; Nervous System; head neurons; neurons along body

• Primary Identifier: Expr1031325
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8829
• Remark: Picture: Figures 2. The expression of wild-type LAT-1 protein or a LAT-1::GFP fusion protein under the control of lat-1 regulatory regions efficiently rescues the mutant phenotype
• Pattern: The expression of lat-1 reporter constructs starts with the onset of zygotic transcription and is initially stronger in the AB lineage than in P1-derived blastomeres. Before the onset of overt morphogenesis, lat-1 is widely expressed in epidermal and pharyngeal precursors and shows a reproducible left-right asymmetry in the epidermal primordium, which results in a striped pattern during dorsal intercalation. In larval and adult stages, lat-1 is expressed in the pharynx, the nervous system, the gonad, and the vulva.

• Primary Identifier: Expr10061
• Remark: Figure 7
• Pattern: Expressed in AIY.

• Primary Identifier: Expr8831
• Remark: Picture: Figures 2.
• Pattern: The endogenous expression level of LAT-1 in embryos is very low, and the protein can only be detected in strains expressing a rescuing transgenic array.
• Subcellular Localization: Immunohistochemical detection with antibodies raised against the LAT-1 N-terminal RBL domain confirms the localization of the protein to the cell membrane.

• Primary Identifier: Expr8828
• Remark: Picture: Figures 2.
• Pattern: lat-1 mRNA is detected in the gonad during oogenesis and in the blastomeres of the early embryo.

• Primary Identifier: Expr3086
• Pattern: In larval stages, expression was most evident in the pharyngeal muscle. There may also have been neuronal expression in the larva, but this was hard to discern in the pharynx region. However, in adults, lat-1 expression appeared to be lost from the muscle but was expressed in anterior neurons, both extra-pharyngeal and pharyngeal, including one neuron in the terminal bulb and neurons of the corpus, with projections into the isthmus. Notably, in the pharynx of adult animals, lat-1 is expressed in neurons rather than muscle.

• Primary Identifier: Expr1020286
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2013016
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr10197
• Pattern: lat-1::gfp is expressed during epidermal dorsal intercalation of the epidermis, specifically only in left epidermoblasts. This results in a highly reproducible zebra-like pattern on the dorsal epidermis prior to syncytial fusion of these cells. In contrast, both nonsuperficial neuroblasts and right intercalating epidermoblasts are devoid of lat-1::gfp expression. Using 4D microscopy lat-1 expression was mapped to ABplaaaap daughters, ABarppaapa, and all four Caaa grand-daughters.

• Primary Identifier: Expr1143238
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1170006
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr2031248
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1710
• Remark: Original chronogram file: chronogram.63.xml
• Reporter Gene: [B0457.1:gfp] transcriptional fusion.

21 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002251
• Start: 8896841
• End: 8908634
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 11794

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00036207
• WBStrain00051140
• WBStrain00055521
• WBStrain00001327

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_8896722..8896840
• Length (nt): 119
• Chromosome Location: II: 8896722-8896840
• Organism: Caenorhabditis elegans