WormMine: Gene WBGene00041581

• WormBase Gene ID: WBGene00041581
• Gene Name: Cbr-npr-25
• Sequence Name: CBG23177
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans npr-25.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23177.1	CBG23177.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23177	CBG23177		[unknown]

0 RNAi Result

26 Allele

• WBVar00133012
• WBVar00132888
• WBVar00132889
• WBVar00132886
• WBVar00133014
• WBVar00132887
• WBVar00133015
• WBVar00132892
• WBVar00132893
• WBVar00132890
• WBVar00132891
• WBVar00132896
• WBVar00027034
• WBVar00132897
• WBVar00132894
• WBVar00132895
• WBVar00132900
• WBVar00132901
• WBVar00132898
• WBVar00132899
• WBVar00132904
• WBVar00132905
• WBVar00132902
• WBVar00132903
• WBVar00132906
• WBVar00132907

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053700
• Remark: CBG23177, CTGATGTGTCCTCATTGTGAAGCTCAACTTTCCATTCGGTCAAGCAGCAATGGGAAGAAA, WBGene00041581
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region