WormMine: Gene WBGene00001250

• WormBase Gene ID: WBGene00001250
• Gene Name: elt-2
• Sequence Name: C33D3.1
• Brief Description: elt-2 encodes a GATA-type transcription factor most similar to the vertebrate GATA4-6 transcription factors required for cardiac and endoderm development (OMIM:601656, 600576); in C. elegans, ELT-2 is required redundantly with ELT-7 for initiating and maintaining terminal differentiation of the intestine and for regulating the intestinal innate immune respone; ELT-2 is expressed solely in the intestine, beginning embryonically at the 2E-cell stage and continuing in all intestinal cells throughout the life of the animal; in the regulatory hierarchy controlling endoderm development, ELT-2 lies downstream of the maternal regulators SKN-1 and POP-1 and the embryonic GATA factors MED-1/-2, and END-1/-3; in turn, ELT-2, along with ELT-7, likely regulates transcription of a number of intestine-specific terminal differentiation genes such as ges-1, ifb-2, pha-4, as well as genes involved in the intestinal innate immune response; ELT-2 also positively autoregulates, presumably to ensure maintenance of intestinal differentiation.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DNA-binding transcription factor activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and enzyme inhibitor activity. Involved in several processes, including defense response to other organism; determination of adult lifespan; and positive regulation of transcription by RNA polymerase II. Located in nucleus. Expressed in several structures, including AWC; Ealaa; Ealp; Earaa; and intestine. Human ortholog(s) of this gene implicated in several diseases, including adenocarcinoma (multiple); artery disease (multiple); and congenital heart disease (multiple). Is an ortholog of human GATA4 (GATA binding protein 4); GATA5 (GATA binding protein 5); and GATA6 (GATA binding protein 6).
• Biotype: SO:0001217
• Genetic Position: X :2.21611 ±0.003108
• Length (nt): 2202

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001250

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C33D3.1.1	C33D3.1.1	1558	X: 10481240-10483441

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C33D3.1	C33D3.1	1302	X: 10481241-10481382

121 RNAi Result

• WBRNAi00096313
• WBRNAi00109089
• WBRNAi00095515
• WBRNAi00096762
• WBRNAi00096761
• WBRNAi00096763
• WBRNAi00096828
• WBRNAi00096830
• WBRNAi00096829
• WBRNAi00096832
• WBRNAi00096831
• WBRNAi00096834
• WBRNAi00096833
• WBRNAi00096836
• WBRNAi00096835
• WBRNAi00096315
• WBRNAi00065119
• WBRNAi00115867
• WBRNAi00041752
• WBRNAi00024712
• WBRNAi00008476
• WBRNAi00085495
• WBRNAi00094015
• WBRNAi00105979
• WBRNAi00106040
• WBRNAi00068785
• WBRNAi00069856
• WBRNAi00094588
• WBRNAi00069786
• WBRNAi00069787

46 Allele

• gk964260
• gk962707
• WBVar01759222
• WBVar01759223
• WBVar01602135
• gk291978
• ok3382
• gk291977
• gk291976
• WBVar01946009
• tm4227
• cxTi6203
• WBVar01894634
• gk291979
• gk415850
• WBVar01551852
• gk596261
• gk367001
• gk795058
• WBVar00099859
• gk313632
• oxTi308
• pk46
• gk351342
• gk373416
• WBVar00099860
• gk746600
• WBVar01551853
• ca15
• tm4468

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001250
• Start: 10481240
• End: 10483441
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10483442..10485349
• Length (nt): 1908
• Chromosome Location: X: 10483442-10485349
• Organism: Caenorhabditis elegans

143 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage.	N.A.	WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in pfd-6(gk493446); daf-2(e1370) comparing to in daf-2(e1370).	Limma version 3.24.15. Fold change < 0.67 (p < 0.05).	WBPaper00055827:pfd-6(gk493446)_downregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral

23 Expression Patterns

• Primary Identifier: Expr5409
• Remark: Strain: BC14255
• Reporter Gene: [elt-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTTCCTGTGATCATGAATTTG] 3' and primer B 5' [GAATGCCAAGAAAATCAAGCA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Marker91
• Remark: Picture: Figure 3D.
• Pattern: str-2::dsRed2 was used as marker for AWCON and srsx-3::GFP was used as marker for AWCOFF.

• Primary Identifier: Expr1030792
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Marker26
• Remark: Picture: Figure 3A, 4A. Reporter gene fusion type not specified.
• Pattern: Expressed in intestinal cells.

• Primary Identifier: Expr7459
• Remark: Clone: pUL#JRH/AH6
• Pattern: Expression is first seen in early embryos in a group of cells. These may be intestinal progenitors because from late embryo to adult expression occurs in intestinal cells.

• Primary Identifier: Chronogram87
• Remark: Original chronogram file: chronogram.1097.xml
• Reporter Gene: [C33D3.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram70
• Remark: Original chronogram file: chronogram.1081.xml
• Reporter Gene: [C33D3.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1216
• Remark: Only embryo was studied. Reporter gene fusion type not specified.
• Pattern: Only the large gut nuclei detected.
• Subcellular Localization: nuclei

• Primary Identifier: Expr1200156
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr12761
• Pattern: A 613 bp minimal promoter can drive gut gfp expression in embryo and adult.

• Primary Identifier: Expr672
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: First detection at 2E cell stage and persists in E lineage throughout embryogenesis (expression pattern same as Ab).

• Primary Identifier: Expr673
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: ELT-2 protein first detected at 2E cell stage (half way through cell cycle and following E-cell ingression associated with gastrulation). At 44-46 cell stage, expression is observed in 2E cells. During all subsequent stages of embryogenesis, ELT-2 protein is detected in all gut lineage, staining is nuclear localized. Protein persists in nuclei of all gut cells, in all larval stages, as well as in adults. Above pattern for male and hermaphrodite.

• Primary Identifier: Expr2011293
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15740
• Pattern: We used qRT-PCR to quantitate elt-2 mRNA levels in wild-type animals during aging. We first used qRT-PCR to compare elt-2 RNA levels in young (L4 larval stage) versus old (day 13 of adulthood) wild-type hermaphrodites. We used six reference genes (let-70, tbb-2, htz-1, pmp-3, Y45F10D.4, cdc-42) as controls, and observed, on average, a two-fold reduction in elt-2 expression in day 13 adults. We then repeated the qRT-PCR experiment to measure elt-2 expression at L4, day 3, day 6, day 9, and day 12 of adulthood using only tbb-2 as a control, and observed a two-fold reduction in elt-2 levels by day 3 of adulthood.

• Primary Identifier: Chronogram156
• Remark: Original chronogram file: chronogram.1160.xml
• Reporter Gene: [C33D3.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1017124
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1145772
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr10289
• Pattern: Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Chronogram1351
• Remark: Original chronogram file: chronogram.2597.xml
• Reporter Gene: [C33D3.1:gfp] transcriptional fusion.

• Primary Identifier: Expr10487
• Pattern: Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr2029529
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12690
• Pattern: CR III in isolation is able to drive expression from the earliest initiation phase (4E) and at all subsequent stages into adulthood.

• Primary Identifier: Expr671
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: elt-2 mRNA is gut-specific and is first detected at the 4E to 8E cell stage.

34 GO Annotation

24 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001250
• Start: 10481240
• End: 10483441
• Strand: 1

34 Ontology Annotations

12 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that are up-regulated in wild-type N2 larvae compared to elt-2(ca15) larvae.	RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison.	WBPaper00053606:N2_vs_elt-2(ca15)_upregulated
	Genes that are down-regulated in wild-type N2 larvae compared to elt-2(ca15) larvae.	RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison.	WBPaper00053606:N2_vs_elt-2(ca15)_downregulated
	Genes that are up-regulated in wild-type N2 larvae compared to elt-2(ca15);elt-7(tm840) larvae.	RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison.	WBPaper00053606:N2_vs_elt-2(ca15);elt-7(tm840)_upregulated
	Genes that are down-regulated in wild-type N2 larvae compared to elt-2(ca15);elt-7(tm840) larvae.	RNA-seq count data were filtered for detected genes (> 10 counts across all samples) and analyzed using DESeq. 2 with Cook's cutoff filtering set to FALSE. Genes were counted as differentially expressed if they registered a Benjamini-Hochberg corrected p-value less than 0.05 and a log2-fold change greater than 1.2 between any pair-wise conditional comparison.	WBPaper00053606:N2_vs_elt-2(ca15);elt-7(tm840)_downregulated
	Transcripts that showed significantly decreased expression in elt-2(RNAi) at L1 larva.	Significant gene expression changes were identified using the RankProd R Package to implement the analysis, which identifies differentially expressed genes at a 10% FDR cutoff.	WBPaper00049484:elt-2(RNAi)_downregulated_L1
	Transcripts that showed significantly decreased expression in elt-2(RNAi) at L4 larva.	Significant gene expression changes were identified using the RankProd R Package to implement the analysis, which identifies differentially expressed genes at a 10% FDR cutoff.	WBPaper00049484:elt-2(RNAi)_downregulated_L4
	Genes that showed significantly decreased expression in elt-2(RNAi) comparing to in control RNAi worms.	Filtering for high-quality data resulted in 7,880 genes with expression values >2.5 fold over background in >70% of the microarrays. These gene expression profiles were analyzed with the SAM microarray analysis package; a two-class testing configuration was used to identify genes differentially-expressed during infection in untreated worms compared to elt-2(RNAi) worms, with a false discovery rate of 9%.	WBPaper00046858:elt-2(RNAi)_downregulated
	Transcripts that showed significantly increased expression in elt-2(RNAi) at L4 larva.	Significant gene expression changes were identified using the RankProd R Package to implement the analysis, which identifies differentially expressed genes at a 10% FDR cutoff.	WBPaper00049484:elt-2(RNAi)_upregulated_L4
	Genes that showed significantly increased expression in elt-2(RNAi) comparing to in control RNAi worms.	Filtering for high-quality data resulted in 7,880 genes with expression values >2.5 fold over background in >70% of the microarrays. These gene expression profiles were analyzed with the SAM microarray analysis package; a two-class testing configuration was used to identify genes differentially-expressed during infection in untreated worms compared to elt-2(RNAi) worms, with a false discovery rate of 9%.	WBPaper00046858:elt-2(RNAi)_upregulated
	Transcripts that showed significantly increased expression in elt-2(RNAi) at L1 larva.	Significant gene expression changes were identified using the RankProd R Package to implement the analysis, which identifies differentially expressed genes at a 10% FDR cutoff.	WBPaper00049484:elt-2(RNAi)_upregulated_L1
Hypoxia	Genes with significant upregulation following hypoxia in an ELT-2-dependent manner. RNAseq were performed on normoxia N2, hypoxia N2, normoxia elt-2(RNAi) and hypoxia elt-2(RNAi) animals.	Cufflinks v2.1.1	WBPaper00045842:elt-2_dependent_hypoxia_upregulated
Hypoxia	Genes with significant downregulation following hypoxia in an ELT-2-dependent manner. RNAseq were performed on normoxia N2, hypoxia N2, normoxia elt-2(RNAi) and hypoxia elt-2(RNAi) animals.	Cufflinks v2.1.1	WBPaper00045842:elt-2_dependent_hypoxia_downregulated

1 Sequence

• Length: 2202

1 Sequence Ontology Term