WormMine: Gene WBGene00004393

• WormBase Gene ID: WBGene00004393
• Gene Name: rnt-1
• Sequence Name: B0414.2
• Brief Description: rnt-1 encodes a transcription factor that is the sole C. elegans member of the Runx family of transcriptional regulators; rnt-1 activity is required for several developmental processes, including regulation of hypodermal seam cell proliferation and proper development of the male tail; rnt-1 mutant animals also exhibit a slight reduction in body size which is enhanced by starvation; RNT-1 can physically interact with SMA-4 and regulates, either directly or indirectly, expression of tlp-1 and cki-1, which encode a C2H2 zinc finger and CDK inhibitor, respectively; RNT-1::GFP reporter fusions are expressed in the nuclei of hypodermal seam cells and transiently in body wall muscles; in males, a RNT-1::GFP is expressed in cells derived from the V5, V6 and T lineages that give rise to the sensory rays.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DNA-binding transcription activator activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and SMAD binding activity. Involved in several processes, including nematode male tail tip morphogenesis; regulation of gene expression; and response to stress. Acts upstream of or within dopamine metabolic process. Located in nucleus. Part of core-binding activity factor complex. Expressed in body wall musculature; intestine; neurons; ray precursor cell; and seam cell. Human ortholog(s) of this gene implicated in several diseases, including carcinoma (multiple); invasive ductal carcinoma; and osteochondrodysplasia (multiple). Is an ortholog of human RUNX2 (RUNX family transcription factor 2) and RUNX3 (RUNX family transcription factor 3).
• Biotype: SO:0001217
• Genetic Position: I :0.447019 ±0.000263
• Length (nt): 12519

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004393

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0414.2.2	B0414.2.2	1575	I: 5776093-5788611
Transcript:B0414.2.3	B0414.2.3	1493	I: 5776146-5788611
Transcript:B0414.2.1	B0414.2.1	1157	I: 5783811-5788610

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0414.2	B0414.2	906	I: 5783841-5783909

8 RNAi Result

• WBRNAi00001354
• WBRNAi00039038
• WBRNAi00064608
• WBRNAi00002853
• WBRNAi00065557
• WBRNAi00028240
• WBRNAi00063835
• WBRNAi00063834

143 Allele

• gk962858
• gk962706
• gk963902
• tm10713
• gk775081
• gk554557
• gk746169
• WBVar01326583
• WBVar01326472
• tm388
• tm491
• WBVar01762320
• gk789900
• gk527448
• gk937792
• gk862356
• ok351
• gk771784
• gk522105
• gk496370
• gk738338
• gk664514
• gk443096
• gk872309
• gk733459
• gk735109
• gk627325
• gk793667
• gk670234
• WBVar01573988

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004393
• Start: 5776093
• End: 5788611
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5788612..5788633
• Length (nt): 22
• Chromosome Location: I: 5788612-5788633
• Organism: Caenorhabditis elegans

121 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L1-larva_expressed
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_12
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_downregulated
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated

22 Expression Patterns

• Primary Identifier: Expr4982
• Remark: Picture: Fig. 4D, 4E.
• Pattern: BRO-1 and RNT-1 are co-expressed in seam and muscle cells.
• Subcellular Localization: Co-localisation is shown using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260) constructs. Faint BRO-1::RFP and RNT-1::GFP co-localisation is also observed in certain body wall muscle cells.

• Primary Identifier: Expr5068
• Remark: Strain: BC11408
• Reporter Gene: [rnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACCACCCATCTATGTT] 3' and primer B 5' [GTTGGTGATTTCTGTTAGTTTCCC] 3'.
• Pattern: Adult Expression: intestine; seam cells; Larval Expression: intestine; seam cells

• Primary Identifier: Expr7886
• Remark: Picture: Figure 1.
• Pattern: rnt-1 expression in the lateral hypodermis was strong at the embryonic stage and gradually decreased after hatching, with expression being still moderately high at L1, but almost undetectable in adults.

• Primary Identifier: Expr7404
• Remark: Clone: pUL#JRH/AB9
• Pattern: Expression is observed in seam cells from 3-fold embryo to adult, although weaker expression from L4 onward. Five nuclei (which may be neurons) are observed expressing in nerve ring area just anterior to the terminal pharyngeal bulb - one pair on both sides, and a single nucleus on the dorsal side. These nuclei are observed through all stages post-embryonically but expression is weak in adults.

• Primary Identifier: Chronogram83
• Remark: Original chronogram file: chronogram.1093.xml
• Reporter Gene: [B0414.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram98
• Remark: Original chronogram file: chronogram.1106.xml
• Reporter Gene: [B0414.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram52
• Remark: Original chronogram file: chronogram.1044.xml
• Reporter Gene: [B0414.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1032204
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr9936
• Pattern: In situ hybridization analysis showed that rnt-1 transcription still occurred in the intestine at the adult stage, whereas GFP-fused RNT-1 proteins were undetectable.

• Primary Identifier: Expr1819
• Remark: Endogenous run expression was confirmed by immunohistochemical staining with antibody raised against the Runt domain. The pattern of endogenous run expression was essentially identical to that of run::GFP in the embryonic and larval stages, suggesting that the run::GFP reporter gene could represent the expression of endogenous run.
• Pattern: Run is expressed in the lateral hypodermis and intestine of C. elegans. Reporter gene expression in embryos from all transformed lines was first detected exclusively in hypodermal seam cells at the bean stage of development. Reporter gene expression was observed in the nuclei of these cells, and expression persisted throughout embryogenesis. Expression of run in seam cell nuclei was detected up until the L3 stage. Between the late embryonic stage and L3 stage, expression was also apparent in gut cell nuclei, with the anterior ring of four cells (int-1) showing the highest level of expression. Expression of run in binucleated gut cells with large nuclei became evident at the L2 stage. At the L3 stage, expression of run in gut cells was significantly decreased except in those cells in the most anterior part of the intestine. Expression in seam cells remained virtually unchanged. By the L4 stage, expression of run was undetectable.
• Subcellular Localization: nuclei

• Primary Identifier: Expr11394
• Remark: Feature : "rnt-1.pSR-MB-p"
• Pattern: The pSR-MB-p region in exon 3 of rnt-1 is required for intestinal cell-specific expression.

• Primary Identifier: Expr3752
• Remark: Cell_group: ray precursor cells and ray sublineages. This rescuing GFP reporter contains the endogenous rnt-1 3'UTR that was absent from the reporter described by Nam et al (see Expr1819). It is possible that this difference in reporters accounts for the slight difference in the rnt-1 expression pattern observed.
• Pattern: rnt-1::GFP is visibly expressed in the nuclei of seam cells in embryos from around 260 minutes post fertilisation, just after the time at which seam cell are formed. Seam cell expression in both males and hermaphrodites is visible during all developmental stages, but is particularly strong until late L2. In males, rnt-1::GFP is expressed additionally in seam cell derived ray precursor cells and ray sublineages. rnt-1::GFP is also expressed transiently in body wall muscle nuclei from late embryogenesis until the end of L2. rnt-1::GFP expression was not observed in any other cell types. Expression of rnt-1 has been previously reported in intestinal cells, but no intestinal expression was found using this rescuing GFP reporter construct.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr3754
• Remark: RNT-1::GFP expression was not observed in T.a and T.p by anti-GFP antibody staining to enhance the GFP signal intensity, or by cultivating worms at 15 centigrades for accumulation and maturation of GFP in T.a and T.p.
• Pattern: At the pre-comma stage, at about 260 min of embryonic development, RNT-1::GFP expression began in the nuclei of the seam cells (H0-2, V1-6 and T cells). At the comma stage, at about 400 min, expression also appeared in the body wall muscle cells . At the L1 larval stage, RNT-1::GFP expression was observed in the seam cells, the body wall muscle cells, and occasionally in the intestinal cells. In the H, V, and T cell lineages, RNT-1::GFP expression was always observed in the seam (self-renewing) cells, but not in the hypodermal syncytial (differentiating) cells, from L1 to adult stages. In addition, RNT-1::GFP expression was observed in the descendants of the M blast cell from late L1 to adult stages. The expression began after two rounds of M cell division, and continued in the body wall muscle descendants. RNT-1::GFP was strongly expressed in the T cells until just before the initiation of mitosis. The expression was diminished in prophase and not visible from metaphase to telophase of the T cell division. The expression was not detectable in either daughter of the T cells, T.a and T.p, but reappeared in the posterior daughters of the T.a cells, T.ap, several hours after the T.a cell division in late L1 stage. After this stage, RNT-1::GFP expression was exclusively observed in T.app and T.appa, but not in either of the other T.ap descendants or any T.p descendants.
• Subcellular Localization: Expressed in the nuclei

• Primary Identifier: Expr11393
• Remark: Feature : "rnt-1.pSR-HM-(5102-6378)"
• Pattern: The pSR-HM-(5102-6378) region in exon 3 of rnt-1 is required for seam cell-specific expression.

• Primary Identifier: Expr14708
• Pattern: Prnt-1::GFP is expressed in dopaminergic neurons.

• Primary Identifier: Expr2015400
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1143198
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1010638
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1124
• Remark: Original chronogram file: chronogram.2247.xml
• Reporter Gene: [B0414.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1200348
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr3118
• Pattern: The GFP reporter protein was indeed detected in the descendant cells of the V5, V6, and T lineages, which include all the A-type neuron, the B-type neuron, and the structural cells of the rays from the mid-L3 stage to L4 stage.

• Primary Identifier: Expr2033634
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

31 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004393
• Start: 5776093
• End: 5788611
• Strand: 1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 12519

1 Sequence Ontology Term