Genomics
5 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C02F4.2a.1 | C02F4.2a.1 |
2852
 |
IV: 10492869-10501599 |
| Transcript:C02F4.2a.2 | C02F4.2a.2 |
2668
|
IV: 10492869-10501127 |
| Transcript:C02F4.2c.1 | C02F4.2c.1 |
2874
|
IV: 10492869-10501600 |
| Transcript:C02F4.2c.2 | C02F4.2c.2 |
2690
|
IV: 10492869-10501128 |
| Transcript:C02F4.2b.1 | C02F4.2b.1 |
1638
|
IV: 10493862-10501060 |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C02F4.2a | C02F4.2a |
1608
|
IV: 10493862-10494052 |
| CDS:C02F4.2c | C02F4.2c |
1629
|
IV: 10493862-10494052 |
| CDS:C02F4.2b | C02F4.2b |
1638
|
IV: 10493862-10494052 |
103 Allele
| Public Name |
|---|
| gk964278 |
| gk964078 |
| gk964500 |
| gk962765 |
| WBVar02021136 |
| gk946561 |
| gk946562 |
| ok491 |
| h17631 |
| db44 |
| db60 |
| jh107 |
| WBVar01453966 |
| ok2065 |
| WBVar01904468 |
| ttTi7395 |
| gk842950 |
| gk476196 |
| gk754970 |
| gk817555 |
| gk878141 |
| gk382935 |
| gk856439 |
| WBVar02037101 |
| gk698186 |
| gk866147 |
| gk557744 |
| WBVar02037100 |
| gk674606 |
| gk850105 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00006527 | 10492869 | 10501600 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
188 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L1-larva_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:AVE-neuron_L1-larva_expressed | |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:bodywall-muscle_L1-larva_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Maternal class (M): genes that are called present in at least one of the three PC6 replicates. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_M | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Bacteria infection: Photorhabdus luminescens | Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection. | MAANOVA and BRB-Array-Tools. | WBPaper00030985:Photorhabdus_luminescens_downregulated |
| Transcripts expressed in vulva. | FPKM >= 1. | WBPaper00064122:vulva_transcriptome | |
| Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_SM | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Expression Pattern Group C, enriched for genes involved in metabolic processes. | The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. | WBPaper00036286:Pattern_C |
20 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4792 | TAX-6::GFP was expressed in neurons and in the cytoplasm and nucleus of intestinal cells. | Expressed in the cytoplasm and nucleus of intestinal cells. | ||
| Expr2035443 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Strain: BC10435 | [tax-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATCCTCTCTCATTTCCCT] 3' and primer B 5' [GATGTCGAGGCGATTGTGT] 3'. | Expr5113 | Adult Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |
| Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Reporter gene fusion type not specified. pAK43 is a larger transgene that should include all promoter regions for tax-6 transcription, since another gene is encoded just upstream of this region and tax-6 mRNA does not seem to be derived from a polycistronic transcript. | Expr1824 | When introduced into wildtype animals, pAK43 drove TAX-6 expression in many sensory neurons, as well as interneurons including AIY and AIZ, and most, if not all, muscle cells. pAK43 is expressed in muscle, AIB, AIY, AIZ, RIA, RIB, RIS, RIM, ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE. It is also expressed in AFD, ASE, AWA, AWC, AVK, AIM, RMDV, AVA. | ||
| Expr3707 | TAX-6 is found in muscles, ventral cord neurons and the ventral cord processes. | TAX-6 is cytosolic, thus it does not appear in clusters (like UNC-38), but uniformly along the nervecord. | ||
| Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Introducing pAK13 into tax-6 mutants rescued thermotaxis and all other defects. | Expr1823 | pAK13 drove TAX-6 expression mostly in sensory neurons, including the thermosensory AFD neurons, the chemosensory ASE, AWA, and AWC neurons, and the osmosensory ASH neurons. pAK13 is expressed in ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE. It is also expressed in AFD, ASE, AWA, AWC, AVK, AIM, RMDV, AVA. | TAX-6 appears to be expressed in the entire cytoplasm of these neurons. In head sensory neurons, for example, GFP fluorescence was visible at sensory cilia, dendrites, axons, and cell bodies. | |
| Cells expressing TAX-6 were visualized using several tax-6::gfp fusion genes. The expression of tax-6 is under diverse transcriptional controls. Reporter gene fusion type not specified. | Expr1825 | Both pAK5 and pAK6 failed to drive TAX-6 expression in AFD thermosensory neurons or chemosensory neurons such as ASE, AWA, and AWC. Compare with Expr1823 and Expr1824. pAK5 and pAK6 are expressed in ASI, ADF, ASH, ASK, ADL, AUA, PHA, PHB, AVE. | ||
| Original chronogram file: chronogram.1007.xml | [C02F4.2:gfp] transcriptional fusion. | Chronogram11 | ||
| Expr1032678 | Tiling arrays expression graphs | |||
| Expr3673 | The strong expression of tax-6 was observed in the intestinal muscle and the anal depressor muscle but not in the sphincter muscle. | |||
| Reporter gene fusion type not specified. tax-6 is called cna-1 in this article. | Expr3057 | Both cna-1 and cnb-1 green fluorescent protein (gfp) reporter transgene expressions were detected at all developmental stages starting from early comma stage embryos to adult stages. Calcineurin also expresses in vulval muscle, body-wall muscle, and in a majority of neuronal cell bodies in the head and tail. Distinct expressions of calcineurin have also been detected in hypodermal seam cells / hypodermal tissue that is required for cuticle formation. Calcineurin also expresses in the male germline, and therefore may have possible roles in germline development. Expr1825 has shown calcineurin to express specifically in sensory neurons and interneurons including muscle cells. | ||
| tax-6 is called cna-1 in this article. | Expr1994 | CNA-1 localization was also confirmed in the spermatheca by immunostaining isolated gonads. Similar localization to GFP expression patterns and additionally showed localization in hypodermal seam cells. See Expr1992 for cna-1::gfp expression patterns. | Wildtype male sperm was examined and immunostained with antiCNA-1 antibody. As expected, robust staining was observed in the wild-type sperm and the staining was distinctly cytoplasmic. | |
| Reporter gene fusion type not specified. | Expr3313 | Strong GFP expression as well as immunostaining of TAX-6 in hypodermal seam cells was detected. | ||
| tax-6 is called cna-1 in this article. | Expr1992 | Expressed in diverse tissues. Expression was detected at all stages of development starting from early comma stage embryos to adult stages. Calcineurin is expressed in vulval muscle, body-wall muscle, spermatheca, and in a majority of neuronal cell bodies in the head and tail similar to previously obtained results. | neuronal cell bodies | |
| Expr1143553 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2017308 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1027545 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Original chronogram file: chronogram.250.xml | [C02F4.2:gfp] transcriptional fusion. | Chronogram1318 | ||
| Original chronogram file: chronogram.719.xml | [C02F4.2:gfp] transcriptional fusion. | Chronogram1807 | ||
| Original chronogram file: chronogram.941.xml | [C02F4.2:gfp] transcriptional fusion. | Chronogram2031 |
64 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00004035) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in |
14 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
64 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00004035) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in |
4 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Genes down regulated in tax-6(ok2065) comparing to in N2. | To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed. | WBPaper00038172:tax-6null_down_regulated | |
| Genes up regulated in tax-6(ok2065) comparing to in N2. | To identify genes that were significantly differentially expressed between each mutant and the control, linear modelling and empirical Bayes analysis was performed using the limma package. Limma computes an empirical Bayes adjustment for the t-test (moderated t-statistic), which is more robust than the standard two-sample t-test comparisons. To correct for multiple testing, Benjamin and Hochbergs method to control for false discovery rate was used. Genes with an adjusted P value of 0.05 or smaller and a fold-change in expression larger than twofold were considered differentially expressed. | WBPaper00038172:tax-6null_up_regulated | |
| Proteins down-regulated more than twofold in tax-6(jh107) mutants. | The gel image was analyzed with Melanie IV software (GeneBio,Geneva, Switzerland). Variance analysis of spot volume and comparisons of mean values of samples from mutant vs. wild-type worms were performed using SAS statistical software, with a significance level of p < 0.05. | WBPaper00027022:tax-6(jh107)_downregulated | |
| Proteins up-regulated more than twofold in tax-6(jh107) mutants. | The gel image was analyzed with Melanie IV software (GeneBio,Geneva, Switzerland). Variance analysis of spot volume and comparisons of mean values of samples from mutant vs. wild-type worms were performed using SAS statistical software, with a significance level of p < 0.05. | WBPaper00027022:tax-6(jh107)_upregulated |